Kandidat Probe Parsial Genom Eimeria tenella Untuk Optimalisasi Diagnosis Koksidiosis = Probe Candidate of Eimeria tenella Partial Genome to Optimalize Coccidiosis Diagnose

https://doi.org/10.22146/jsv.372

Sumartono .(1*)

(1) 
(*) Corresponding Author

Abstract


Penelitian ini bertujuan untuk mencari kandidat probe yang dapat digunakan untuk mengoptimalisasi diagnosis koksidiosis berdasarkan fragmen genom Eimeria tenella. Kandidat tersebut ditentukan berdasarkan analisis DNA dari 5 isolat Eimeria tenella ( Jepang, Yogya, Magelang, Solo dan Boyolali ). Isolasi DNA dilakukan dengan metode fenol-khloroformisoamilalkohoI, sedang amplifikasi fragmen DNA dilakukan dengan metode PCR menggunakan forward primer GCTGTGGCCAGAGCAAC dan reverse primer CAACTCCATCGGGCCCA. Sekuensing produk PCR yang ukurannya sarna besar dilakukan di laboratorium Eijkman dan analisis sekuen dilakukan dengan Gene-analyser Genetyx-Max versi 9. Kesimpulan penelitian adalah bahwa sekuen GGCACAGTATCCTCCTTCAGGGCAGGGCT CGCACTGGTCAAACGCGGTA CCATT dan GCCTAAA.TTCATGACCACACACTA merupakan kandidat probe parsial genom E. tenella untuk pengembangan diagnosis koksidiosis.




DOI: https://doi.org/10.22146/jsv.372

Article Metrics

Abstract views : 428

Refbacks

  • There are currently no refbacks.




Copyright (c) 2012 Jurnal Sain Veteriner

Creative Commons License
This work is licensed under a Creative Commons Attribution-ShareAlike 4.0 International License.

Jurnal Sain Veteriner Indexed by

    CrossrefROADCOREDimensions  JournalTOCs   


Copyright of JSV (Jurnal Sain Veteriner) ISSN 0126-0421 (print), ISSN 2407-3733 (online).

Fakultas Kedokteran Hewan, Universitas Gadjah Mada

Jl. Fauna No.2, Karangmalang, Yogyakarta

Phone: 0274-560862

Fax: 0274-560861

Email: jsv_fkh@ugm.ac.id

Jurnal Sain Veteriner is licensed under a Creative Commons Attribution-ShareAlike 4.0 International License.

 

free
web stats View My Stats