A Development of Homolog Sequence of Eimeria tenella Partial Genome as a Probe for Molecular Diagnosis of Coccidiosis

https://doi.org/10.22146/ijbiotech.7409

S. Sumartono(1*)

(1) 
(*) Corresponding Author

Abstract


The goal of the research was to develop a homolog sequence of Eimeria tenella partial genome as a molecular
probe for diagnose coccidiosis using dot blot method. A probe of homolog sequence of E.tenella partial genome
and a non radioactive label, dig-11-dUTP, were used for this research. Four concentrations of molecular probe
labeled with dig-11-dUTP, namely, 158,33 pg/μl, 52,25 pg/μl, 15,83 pg/μl and 5,225 pg/μl were tested to detect
0,6551 μg DNA target. The procedure of labeling and hybridization detection between DNA target with the
molecular probe labeled with dig-11-dUTP were carried out with Digh high prime DNA labeling and detection
starter Kit I. The conclusion of the research was that 52,25 pg/μl molecular probe or more which its sequence
GGCA CAGTATCCTCCTTCAGGGCAGGG CTCGCACTGGTCAAA CGCGG TAC CATT could detect DNA
target by dot blot method.
Keywords: coccidiosis, E. tenella genome, molecular probe, dot blot hybridization

Full Text:

PDF



DOI: https://doi.org/10.22146/ijbiotech.7409

Article Metrics

Abstract views : 278 | views : 132

Refbacks

  • There are currently no refbacks.


Copyright (c) 2015 Indonesian Journal of Biotechnology



The Indonesian Journal of Biotechnology (print ISSN 0853-8654; online ISSN 2089-2241) is published by the Research Center for Biotechnology in collaboration with the Graduate School of Universitas Gadjah Mada. The content of this website is licensed under a Creative Commons Attribution-ShareAlike 4.0 International License, and attributable to Siti Nurleily Marliana and Joaquim Baeta. Built on the Public Knowledge Project's OJS 2.4.8.1. Web
Analytics View website statistics.