A Development of Homolog Sequence of Eimeria tenella Partial Genome as a Probe for Molecular Diagnosis of Coccidiosis

https://doi.org/10.22146/ijbiotech.7409

S. Sumartono(1*)

(1) 
(*) Corresponding Author

Abstract


The goal of the research was to develop a homolog sequence of Eimeria tenella partial genome as a molecular
probe for diagnose coccidiosis using dot blot method. A probe of homolog sequence of E.tenella partial genome
and a non radioactive label, dig-11-dUTP, were used for this research. Four concentrations of molecular probe
labeled with dig-11-dUTP, namely, 158,33 pg/μl, 52,25 pg/μl, 15,83 pg/μl and 5,225 pg/μl were tested to detect
0,6551 μg DNA target. The procedure of labeling and hybridization detection between DNA target with the
molecular probe labeled with dig-11-dUTP were carried out with Digh high prime DNA labeling and detection
starter Kit I. The conclusion of the research was that 52,25 pg/μl molecular probe or more which its sequence
GGCA CAGTATCCTCCTTCAGGGCAGGG CTCGCACTGGTCAAA CGCGG TAC CATT could detect DNA
target by dot blot method.
Keywords: coccidiosis, E. tenella genome, molecular probe, dot blot hybridization

Full Text:

PDF



DOI: https://doi.org/10.22146/ijbiotech.7409

Article Metrics

Abstract views : 297 | views : 151

Refbacks

  • There are currently no refbacks.


Copyright (c) 2015 Indonesian Journal of Biotechnology



Past issues



The Indonesian Journal of Biotechnology (print ISSN 0853-8654; online ISSN 2089-2241) is published by the Research Center for Biotechnology in collaboration with the Graduate School of Universitas Gadjah Mada. The content of this website is licensed under a Creative Commons Attribution-ShareAlike 4.0 International License, and attributable to Siti Nurleily Marliana and Joaquim Baeta. Built on the Public Knowledge Project's OJS 2.4.8.1 and designed by Joaquim Baeta. Web
Analytics View website statistics.