2024-03-29T11:44:18Z
https://journal.ugm.ac.id/index/oai
oai:ojs.journal.ugm.ac.id:article/6603
2015-11-09T04:24:52Z
ijbiotech:ART
oai:ojs.journal.ugm.ac.id:article/6604
2015-11-09T04:24:52Z
ijbiotech:ART
oai:jurnal.ugm.ac.id:article/7409
2020-02-14T05:13:55Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7409
2020-02-14T05:13:55Z
Indonesian Journal of Biotechnology
Vol 10, No 1 (2005)
A Development of Homolog Sequence of Eimeria tenella Partial Genome as a Probe for Molecular Diagnosis of Coccidiosis
Original Research Articles
Sumartono, S.; Parasitology Department, Faculty of Veterinary Medicine Gadjah Mada University, Jl. Olah RagaKarangmalang Yogyakarta 55281, Indonesia
2005-06-13 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7409
coccidiosis, E. tenella genome, molecular probe, dot blot hybridization
The goal of the research was to develop a homolog sequence of Eimeria tenella partial genome as a molecular probe for diagnose coccidiosis using dot blot method. A probe of homolog sequence of E.tenella partial genome and a non radioactive label, dig-11-dUTP, were used for this research. Four concentrations of molecular probe labeled with dig-11-dUTP, namely, 158,33 pg/µl, 52,25 pg/µl, 15,83 pg/µl and 5,225 pg/µl were tested to detect 0,6551 µg DNA target. The procedure of labeling and hybridization detection between DNA target with the molecular probe labeled with dig-11-dUTP were carried out with Digh high prime DNA labeling and detection starter Kit I. The conclusion of the research was that 52,25 pg/µl molecular probe or more which its sequence GGCA CAGTATCCTCCTTCAGGGCAGGG CTCGCACTGGTCAAA CGCGG TAC CATT could detect DNA target by dot blot method.
oai:jurnal.ugm.ac.id:article/7410
2020-02-14T05:13:55Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7410
2020-02-14T05:13:55Z
Indonesian Journal of Biotechnology
Vol 10, No 1 (2005)
Cloning Gene Encoding Micronema 3 (Mic3) Protein of Tachyzoite Toxoplasma Gondii Local Isolate
Original Research Articles
Artama, Wayan T.; Research Center for Biotechnology, Gadjah Mada University, Yogyakarta 55281, Indonesia; Faculty of Veterinary Medicine, Gadjah Mada University, Yogyakarta 55281, Indonesia
Dewi, Ni Nyoman Ayu; Research Center for Biotechnology, Gadjah Mada University, Yogyakarta 55281, Indonesia; Faculty of Medicine Udayana University, Denpasar 80114, Indonesia
Subekti, Didik Tulus; BALITVET, Bogor, Indonesia
2005-06-13 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7410
MIC3 protein, Toxoplasma gondii, tachyzoite, recombinant DNA
Microneme 3 (MIC3) protein tachyzoites Toxoplasma gondii is one of protein which plays an important role during cell host invasion. Gene encoding MIC3 protein has been studied and it was suggested a potent vaccine candidate against Toxoplasma gondii infection. The aim of this research is to clone and sequence the gene encoding MIC3 protein of tachyzoites Toxoplasma gondii local isolate by amplification using polymerase chain reaction with specific primers. The amplified DNA fragment was cloned into pGEM-T and transformed into E. coli XL-1 Blue by heat shock method. Recombinant plasmids were isolated using alkali lysis method and analyzed by digestion using restriction endonuclease enzymes PstI, HindIII, NcoI and EcoRV. The recombinant plasmids then sequenced to find out the nucleotide sequence of insert gene by ABIPRISM 377 DNA Sequencer. The DNA sequence then were analyzed by computer software for alignment. The result showed that transformation in E. coli XL-1 Blue by pGEM-T produced one clone that was encoding MIC3 protein. Analysis of 489 bp from 5’ and 447 from 3’ of gene sequence showed 97-98% homology with gene encoding for MIC3 protein of RH isolate.
oai:jurnal.ugm.ac.id:article/7411
2020-02-14T05:13:55Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7411
2020-02-14T05:13:55Z
Indonesian Journal of Biotechnology
Vol 10, No 1 (2005)
Cloning of cDNA Encoding GRA1 Protein of Tachyzoite Toxoplasma Gondii Local Isolate
Original Research Articles
Sulistyaningsih, Erma; Faculty of Medicine, Jember University, Jember 68121, Indonesia
Moeljopawiro, Sukarti; Faculty of Biology, Gadjah Mada University, Yogyakarta 55281, Indonesia
Subandono, Jarot; Faculty of Medicine, Sebelas Maret State University, Solo, Indonesia
Artama, Wayan T.; Faculty of Veterinary Medicine, Gadjah Mada University, Yogyakarta 55281, Indonesia
2005-06-13 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7411
Gene encoding GRA1 protein is potent DNA-vaccine candidate against toxoplasmosis. The aim of the research was to clone the gene encoding GRA1 protein of tachyzoite Toxoplasma gondii local isolate by DNA recombinant technology. Tachyzoite was grown in Balb/c mice in vivo. Messenger RNA was isolated from total RNA and it was used to synthesis cDNA. Complementary DNA encoding GRA1 protein of tachyzoite Toxoplasma gondii local isolate was amplified and cloned in a prokaryote cloning vector. The recombinant GRA1-encoding gene was then digesting using EcoRI restriction endonuclease and sequencing. The result showed that the recombinant GRA1- encoding gene consisted of DNA sequences encoding all signal peptide and mature peptide of GRA1 protein. Alignment of recombinant GRA1 sequence to gene encoding GRA1 protein of Toxoplasma gondii RH isolate showed 100% homologous.
oai:jurnal.ugm.ac.id:article/7412
2020-02-14T05:13:55Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7412
2020-02-14T05:13:55Z
Indonesian Journal of Biotechnology
Vol 10, No 1 (2005)
Expression Analysis and Nuclear Import Study of Full-length Isoforms Importin α as 6x Histidin-tagged Fusion Protein on the Intracellular Localization of Recombinant HBV Core Protein
Original Research Articles
Haryanto, Aris; Department of Biochemistry, Faculty of Veterinary Medicine, Gadjah Mada University, Yogyakarta 55281
2005-06-13 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7412
NPC; NLS; importin α; importin β; isoforms importin α as 6x histidin-tagged fusion protein; WT rHBc; SV40 Tag; co-immunoprecipitation; westernblotting
en
Isoform importin α molecules play a central role in the classical nuclear import pathway, that occurs through the nuclear pore complex (NPC) and typically requires a specific nuclear localization signal (NLS). In this study, it was investigated the role of isoforms importin α in the nuclear import of wild type recombinant hepatitis B virus core protein (WT rHBc), phosphorylated recombinant HBV core (rHBc) and recombinant HBV core without NLS by co-immunoprecipitation. Four recombinant full-length isoforms importin α as 6x histidin-tagged fusion protein were expressed and analysed from expression plasmid vectors Rch1, pHM 1969, pHM 1967 and pHM 1965. The results indicated that importin α-1, importin α-3, importin α-4 and importin α-5 can be expressed and isolated from E. coli transformed recombinant DNA plasmid as protein in size around 58-60 kDa. By the nuclear transport study shown that isoforms importin α are involved in the nuclear import of WT rHBc, phosphorylated rHBc and rHBc without NLS. It also indicated that they have an important role for nuclear transport of from cytoplasm into the nucleus.
oai:jurnal.ugm.ac.id:article/7413
2020-02-14T05:13:55Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7413
2020-02-14T05:13:55Z
Indonesian Journal of Biotechnology
Vol 10, No 1 (2005)
Genetic Analysis of Glycoprotein Gene of Indonesian Rabies Virus
Original Research Articles
Susetya, Heru; Department of Veterinary Public Health Faculty of Veterinary Medicine, Gadjah Mada University,Yogyakarta, Indonesia
Naoto, Ito; United Graduate School of Veterinary Science, Gifu University, Japan
Sugiyama, Makoto; United Graduate School of Veterinary Science, Gifu University, Japan
Minamoto, Nobuyuki; United Graduate School of Veterinary Science, Gifu University, Japan
2005-06-13 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7413
Rabies virus, Glycoprotein gene, Ectodomain, Phylogenetic analysis
The amino acid sequences of the Glycoprotein gene (G gene) of field rabies virus SN01-23 from Indonesia was determined. This isolate showed homology of 93% in the ectodomain of the Glycoprotein gene to that of the RC-HL strain, which is used for production of animal vaccine in Japan. The high identity in the ectodomain between this field isolate and strain RC-HL suggest that the rabies animal vaccine used in Japan will be effective for rabies street viruses in Indonesia. Result of phylogenetic analysis using the nucleotide sequences of the G genes of rabies street viruses showed that SN01-23 from Indonesia is more closely related to a rabies virus from China than to viruses from Thailand and Malaysia. This genetic data and historical background suggest that rabies viruses in China had been transferred to Indonesia through dogs brought by humans migrating from China to Indonesia.
oai:jurnal.ugm.ac.id:article/7553
2020-02-14T07:17:28Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7553
2020-02-14T07:17:28Z
Indonesian Journal of Biotechnology
Vol 10, No 2 (2005); 822-829
Relationship between Nucleus Swelling and Development Competence of Bovine Cloned Embryos Reconstructed by Enucleated Oocytes with Serum-starved or Serum-fed Fetal Somatic Cells
Original Research Articles
Fahrudin, Mokhamad; Faculty of Veterinary Medicine, Bogor Agricultural University, Bogor 16680, Indonesia
Karja, Ni Wayan Kurniani; Department of Reproduction and Obstetric, Faculty of Veterinary Medicine, Gadjah Mada University,Yogyakarta 55281, Indonesia
Suzuki, Tatsuyuki; Laboratory of Animal Reproduction and Biotechnology, The United Graduate School of VeterinarySciences, Yamaguchi University, Yamaguchi 753-8515, Japan
2005-12-15 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7553
nuclear transplantation technique-somatic cells-nucleus swelling
en
This study was conducted to examine the occurrence of nuclear remodeling (nucleus swelling) and its effects on the subsequent in vitro development of bovine embryos reconstructed by serum-starved and serum-fed somatic cells. Results from this study demonstrated that all of the reconstructed embryos that received serum-starved and serum-fed somatic cells exhibited condensed-nuclei. More than 90% of the transferred nuclei exhibited nuclear envelope breakdown and premature chromatin condensation which clearly distinct from an intact nucleus. There was no significant difference on the degree of nucleus swelling in SS-NT embryos or SF-NT embryos, indicating that either serum-starved or confluent somatic cell lines could be reprogrammed by the recipient cytoplasm environments in similar pattern. Although the fusion rate was not significantly different among the groups, the proportion of SS-NT embryos which developed to the 2- to 4-cell stage (89.7%) and to the 8- to 16-cell stage (74.7%) was significantly higher than that of SF-NT embryos. Whereas, the proportion of reconstructed embryos that developed to the morula and blastocyst stages were not significantly different among the groups. Results of these studies demonstrate that reconstructed embryos, which received either serum-starved or serum-fed confluent somatic cells, showed similar developmental competence to the blastocyst stage.
oai:jurnal.ugm.ac.id:article/7554
2020-02-14T07:17:28Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7554
2020-02-14T07:17:28Z
Indonesian Journal of Biotechnology
Vol 10, No 2 (2005); 830-839
Analysis of Htra Gene from Zebrafish (Danio Rerio)
Original Research Articles
Murwantoko, M.; Department of Fisheries, Faculty of Agriculture, Gadjah Mada University, Bulaksumur,Yogyakarta 55281, Indonesia
Oka, Chio; Laboratory of Gene Function in Animals, Department of Molecular Biology, Graduate School ofBiological Science, Nara Institute of Science and Technology 8916-5 Takayama, Ikoma, Nara630-0101, Japan
Kawaichi, Masashi; Laboratory of Gene Function in Animals, Department of Molecular Biology, Graduate School ofBiological Science, Nara Institute of Science and Technology 8916-5 Takayama, Ikoma, Nara630-0101, Japan
2005-12-15 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7554
HtrA which is characterized by the combination of a trypsin-like catalytic domain with at least one C-terminal PDZ domain is a highly conserved family of serine proteases found in a wide range of organisms. However the identified HtrA family numbers varies among spesies, for example the number of mammalian, Eschericia coli, fruit fly-HtrA family are 4, 3 and 1 gene respectively. One gene is predicted exist in zebrafish. Since no complete information available on zebrafish HtrA, in this paper zebrafish HtrA (zHtrA) gene was analyzed. The zHtrA is belonged to HtrA1 member and predicted encodes 478 amino acids with a signal peptide, a IGF binding domain, a Kazal-type inhibitor domain in the up stream of HtrA-bacterial homolog. At the amino acid sequence the zHtrA1 showed the 69%, 69%, 68%, 54% and 54% with the rat HtrA1, mouse HtrA1, human HtrA1, human HtrA3 and mouse HtrA4 respectively. The zHtrA1 is firstly expressed at 60 hpf and mainly in the vertebral rudiments in the tail region.
oai:jurnal.ugm.ac.id:article/7555
2020-02-14T07:17:28Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7555
2020-02-14T07:17:28Z
Indonesian Journal of Biotechnology
Vol 10, No 2 (2005); 840-847
Cloning and Sequencing cDNA Encoding for Rhoptry-2 Toxoplasma Gondii Tachyzoite Local Isolate
Original Research Articles
Artama, Wayan T.; Research Center for Biotechnology, Gadjah Mada University, Yogyakarta 55281, Indonesia.Faculty of Veterinary Medicine, Gadjah Mada University, Yogyakarta 55281, Indonesia
Sari, Yulia; Research Center for Biotechnology, Gadjah Mada University, Yogyakarta 55281, Indonesia.Faculty of Biology, Gadjah Mada University, Yogyakarta 55281, Indonesia
Subekti, Didik Tulus; Research Institute for Veterinary Science, Bogor, Indonesia
Poerwanto, Soenarwan Hery; Faculty of Biology, Gadjah Mada University, Yogyakarta 55281, Indonesia
Subandono, Jarot; Faculty of Medicine, University of Surakarta, Indonesia
2005-12-15 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7555
Toxoplasma gondii, tachizoite, ESA, complementary DNA, ROP2
Rhoptry protein belongs to an excretory and secretory antigens (ESAs) that play an important role during active penetration of parasite into the cell target. This protein an able Toxoplasma gondii to actively penetrate targeted cell, meanwhile ESAs protein stimulates intracellular vacuole modification. It is, therefore, after the parasite successfully enter the cell target then Granule (GRA) proteins are responsible for the formation of parasitophorus vacuole, which is protect the fusion with other intracellular compartments such as lysosomal vacuole. Consequently, this parasite is being able to survive and multiply at the cell target. The current study was aimed to clone and sequens cDNA encoding for ROP-2 of local isolated T. gondii tachizoite through DNA recombinant technique. Total ribonucleic acid (RNA) was isolated from tachyzoites of local isolated T. gondii that were grown up in Balb/ c mice. Messenger RNA was isolated from total RNA using PolyAtract mRNA Isolation System. Messenger RNA was used as a template for synthesis cDNA using Riboclone cDNA Synthesis System AMV-RT. EcoRI adaptor from Riboclone EcoRI Adaptor Ligation System was added to Complementary DNA and than ligated to pUC19. Recombinant plasmid was transformed into E. coli (XL1-Blue). The transformed E. coli XL-1 Blue were plated on LB agar containing X-Gal, IPTG and ampicillin. Recombinant clones (white colony) were picked up and grown up in the LB medium at 37oC overnight. Expression of recombinant protein was analysed by immunoblotting in order to identify cDNA recombinant wich is express ESA of T. gondii local isolate. Recombinant plasmid were isolated using alkalilysis method and were elektroforated in 1% agarose gel. The isolated DNA recombinant plasmid was cut using Eco RI and then sequenced through Big Dye Terminator Mix AB1 377A Sequencer using M13 Forward and M13 Reverse primers. The conclusion of this results showed that the recombinant clone was coding for excretory and secretory protein which has molecular weight of 54 kDa. The DNA alignments of sequence from the cloned gene showed 97% homology with gene encoding for ROP-2 of T. gondii RH isolate.
oai:jurnal.ugm.ac.id:article/7556
2020-02-14T07:17:28Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7556
2020-02-14T07:17:28Z
Indonesian Journal of Biotechnology
Vol 10, No 2 (2005); 848-853
Distribution of Camphor Monooxygenase Genes in Soil Bacteria
Original Research Articles
Ngadiman, N.; Laboratory of Microbiology, Faculty of Agriculture, Gadjah Mada University, Yogyakarta, Indonesia
Suenaga, Hikaru; National Institute of Advanced Industrial Science and Technology, Tokyo, Japan
Goto, Masatoshi; Laboratory of Applied Microbiology, Faculty of Agriculture, Kyushu University, Fukuoka, Japan
Furukawa, Kensuke; Laboratory of Applied Microbiology, Faculty of Agriculture, Kyushu University, Fukuoka, Japan
2005-12-15 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7556
Camphor monooxygenase genes, gene distribution, sail bacteria
en
In microbial degradation of camphor, the first step is oxidation by multiunit enzyme, camphor monooxygenase, encoded by cam genes (camA,B,C). Seven camphor-utilizing bacterial strains have been isolated from soil at various locations. CamA,B,C genes of Pseudomonas putida strain PpG1 and strain GF2001 were used as probes to explore their abundance in the camphor-utilizing bacteria. Southern analysis revealed that all of the cam genes of GF2001 could hybridize well to the SpeI-digested genomic DNA of strains tested, whereas PpG1 cam genes were not. This result suggested that the GF2001 type cam genes are widely distributed among the camphor- utilizing strains in the environment. Thus strain GF2001 and seven newly isolated strains share a common evolutionary origin.
oai:jurnal.ugm.ac.id:article/7557
2020-02-14T07:17:28Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7557
2020-02-14T07:17:28Z
Indonesian Journal of Biotechnology
Vol 10, No 2 (2005); 807-813
Nuclear Import Analysis of Two Different Fluorescent Marker Proteins into Hepatocyte Cell Lines (HuH-7 Cell)
Original Research Articles
Haryanto, Aris; Department of Biochemistry, Faculty of Veterinary Medicine, Gadjah Mada University.Jl. Olahraga, Karangmalang, Yogyakarta 55281, Indonesia
Kann, Michael; Institute of Medical Virology, Justus-Liebig-University, Giessen, Germany.Frankfurterstrasse 107, 35392 Giessen, Germany
2005-12-15 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7557
EGFP, DsRed2 fluorescent protein , HuH-7 cell, HBV, intracellular localization
The application of fluorescent proteins as expression markers and protein fusion partners has proved immensely valuable for resolving the organization of biological events in living cells. EGFP and DsRed2 are commonly fluorescent marker protein which is used for biotechnology and cell biology research. The present study was designed to identify the expression vector that suitable to ligate with DNA encoding HBV core protein for intracellular localization study in hepatocyte cell, which were expressed as fusion proteins. We also compared and quantified the expressed fluorescent protein which predominantly localized in the cell compartment. The results indicated that DsRed2 shown as less than ideal for intracellular localization study of than EGFP, because of its tetrameric structure of the fluorescent protein and when fused to a protein of interest, the fusion protein often forms aggregates in the living cells. In contrast, EGFP fluorescent protein shown a much higher proportion of cytoplasmic localization, thus being more suitable for analysis of intracellular localization than DsRed2 fluorescent protein. EGFP fluorescent protein is also capable to produce a strong green fluorescence when excited by blue light, without any exogenously added substrate or cofactor, events inside living cell can thus be visualized in a non-invasive way. Based on our present quantitative data and some reasons above shown that EGFP is more suitable than DsRed2 as a fluorescent marker protein for intracellular localization study into HuH-7 cell.
oai:jurnal.ugm.ac.id:article/7558
2020-02-14T07:17:28Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7558
2020-02-14T07:17:28Z
Indonesian Journal of Biotechnology
Vol 10, No 2 (2005); 814-821
Mineral Phosphate Solubilizing Bacteria Isolated from Various Plant Rhizosphere under Different Aluminum Content
Original Research Articles
Damarjaya, Dolly Iriani; Laboratory of Soil and Environmental Microbiology, Department of Agriculture Microbiology,Faculty of Agriculture, University of Gadjah Mada, Bulaksumur, Yogyakarta 55281, Indonesia
Widada, Jaka; Laboratory of Soil and Environmental Microbiology, Department of Agriculture Microbiology,Faculty of Agriculture, University of Gadjah Mada, Bulaksumur, Yogyakarta 55281, Indonesia
Senoo, Keishi; Graduate School of Agricultural and Life Sciences, The University of Tokyo. 1-1-1 Yayoi,Bunkyo-ku, Tokyo 113-8657, Japan
Nishiyama, Masaya; Graduate School of Agricultural and Life Sciences, The University of Tokyo. 1-1-1 Yayoi,Bunkyo-ku, Tokyo 113-8657, Japan
Otsuka, Shigeto; Graduate School of Agricultural and Life Sciences, The University of Tokyo. 1-1-1 Yayoi,Bunkyo-ku, Tokyo 113-8657, Japan
2005-12-15 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7558
The objectives of this study was to isolate and characterize the mineral phosphate solubilizing bacteria from rhizosphere and evaluate their potential as plant growth promoting bacteria in Al-toxic soils. The halo zone formation method was used to isolate PSB using the media containing insoluble phosphates (Ca-P or Al-P) as a source of phosphate. Eight of acid and Al-tolerant PSB isolates that were able to solubilize Ca-P were obtained from rhizosphere of clover, wheat, corn, and sunflower grown in Al-toxic soil. Identification of the isolates based on the 16S rRNA gene sequence analysis demonstrated that the isolates were strains of Burkholderia (5 strains), Pseudomonas (1 strain), Ralstonia (1 strain), and unidentified bacterium (1 strains). All PSB isolates showed the capability to dissolve Ca-P, and only 1 strain (Ralstonia strain) was able to dissolve Al-P in agar plate medium. The P-solubilization by these isolates was correlated with pH of medium. Inoculation of the bacterial strains on clover on Al-toxic medium showed that all isolates increased the plant dry weight compared with uninoculated treatment. Our results showed that those PSB isolates have potential to be developed as a biofertilizer to increase the efficiency of P-inorganic fertilizer used in Al-toxic soils.
oai:jurnal.ugm.ac.id:article/7559
2020-02-14T07:19:15Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7559
2020-02-14T07:19:15Z
Indonesian Journal of Biotechnology
Vol 11, No 1 (2006); 1111-1116
Production of Poly-α-hydroxybutyrate (PHB) from Sago Starch by The Native Isolate Bacillus megaterium PSA10
Original Research Articles
Yanti, Nur Arfa; Study Program of Biology, FKIP, Haluoleo University, Kendari, IndonesiaLaboratory of Microbiology, Faculty of Biology Gadjah Mada University, Yogyakarta, Indonesia
Sembiring, Langkah; Laboratory of Microbiology, Faculty of Biology Gadjah Mada University, Yogyakarta, Indonesia
Margino, Sebastian; Laboratory of Agriculture Microbiology, Faculty of Agriculture, Gadjah Mada University, Yogyakarta, Indonesia
2006-06-01 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7559
Amylase, Poly--hydroxybutyrate (PHB), Bacillus megaterium, 16S rDNA
en
A new bacterial strain that produces amylase and poly-α-hidroxybutyrate (PHB) using sago starch as carbon source was characterized and identified to be member of the Bacillus megaterium group based on phenotypic characteristics and 16S rDNA gene sequences. Amylase activity was determined spectrophotometrically on the basis of substrate concentration reduction. PHB production was quantified with UV spectrophotometer. The polymer produced by B. megaterium PSA10 was identified by Fourier Transform Infrared spectroscopy (FTIR). The result of the study showed that the amylase specific activity B. megaterium PSA10 was 593,61 DUN/mg protein and PHB production from sago starch was 52,28 % of cell dry weight (CDW). FTIR analysis of the polymer indicated that the strain B.megaterium PSA10 was a potent PHB producer.
oai:jurnal.ugm.ac.id:article/7560
2020-02-14T07:19:15Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7560
2020-02-14T07:19:15Z
Indonesian Journal of Biotechnology
Vol 11, No 1 (2006); 855-861
Developmental Competence of Early Stage Porcine Embryos Cultured in Medium with Different Energy Substrate in vitro
Original Research Articles
Karja, Ni Wayan Kurniani; Department of Reproduction and Obstetric, Faculty of Veterinary Medicine, Gadjah Mada University,Yogyakarta 55281, Indonesia.Department of Animal Sciences, Reproductive Biology Research Unit, National Institute of Agrobiological Sciences, Tsukuba, Ibaraki 305-8602, Japan
Kikuchi, Kazuhiro; Department of Animal Sciences, Reproductive Biology Research Unit, National Institute of Agrobiological Sciences, Tsukuba, Ibaraki 305-8602, Japan
Fahrudin, Mokhamad; Faculty of Veterinary Medicine, Bogor Agricultural University, Bogor 16680, Indonesia.Department of Animal Sciences, Reproductive Biology Research Unit, National Institute of Agrobiological Sciences, Tsukuba, Ibaraki 305-8602, Japan
2006-06-01 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7560
porcine embryos-energy substrate-in vitro culture
To elucidate the effect of energy requirement during the early embryonic development on their developmental ability to develop to blastocyst stage, in vitro fertilized (IVF) porcine one-cell embryos were cultured in modified North Carolina State University (NCSU)-37 supplemented with different energy substrate. Result indicated that the cleavage rate of embryos in Pyr-Lac and Gluc-Pyr-Lact groups was significantly higher than in those in Gluc group and Gluc-Rib group (P < 0.05). At Day 6 of culture, the highest proportion of embryos develop to the blastocyst stage was obtained in the presence of pyruvate-lactate only. In the medium with glucose, the addition of pyruvate-lactate or ribose slightly increased the proportion of embryos develop to the blastocyst stage, however the value were not significantly different form those obtained in the presence of glucose only. The mean cell number in blastocysts derived from Pyr-Lac and Gluc-Pyr-Lact groups were significantly higher than those in the Gluc group (P < 0.05). These results indicated that the presence of glucose only, as energy substrate, during the first 2 days of in vitro culture (IVC) caused a decrease in development of in vitro produced (IVP) porcine embryos to the blastocyst stage and mean cell number in blastocysts.
oai:jurnal.ugm.ac.id:article/7561
2020-02-14T07:19:15Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7561
2020-02-14T07:19:15Z
Indonesian Journal of Biotechnology
Vol 11, No 1 (2006); 870-877
Effect of Probiotic Lactobacillus sp. Dad13 on Humoral Immune Response of Balb/C Mice Infected with Salmonella typhimurium
Original Research Articles
Kusumawati, Ika Dyah; Reaserch Center for Biotechnology, Gadjah Mada University, Yogyakarta, Indonesia
Harmayani, Eni; Faculty of Agriculture Technology, Gadjah Mada University, Yogyakarta, Indonesia
Asmara, Widya; Reaserch Center for Biotechnology, Gadjah Mada University, Yogyakarta, Indonesia.Faculty of Veterinary Medicine, Gadjah Mada University, Yogyakarta, Indonesia
2006-06-01 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7561
Probiotic, Lactobacillus sp. Dad13, Immune response, Salmonella typhimurium
en
An indigenous strain of lactic acid bacterium (LAB) identified as Lactobacillus spp. Dad13 (Dad13), isolated from traditional fermented buffalo milk, was found to be potential as probiotic. The aim of this research was to study the effect of probiotic Dad13 on humoral immune response of Balb/C mice infected with Salmonella typhimurium. The specific objective was to find out the effect of different Dad13 consumption time (before and along with infection of S. typhimurium) on the humoral immune response of Balb/C mice. The experiment was conducted by in vivo trial on 20 males of Balb/C mice, age of 6-8 weeks, fed with AIN-93 standard diet. The mice were assigned into 4 groups. Each group received the following treatments, ie. Dad13 only, Dad13 before infection, Dad13 along with infection and Salmonella infection only. A volume of 100 µl Dad13 cell suspensions (1010 CFU/ml) were given by oral forced feeding daily for a week, at week 3 for group before infection and at week 4 for group of Dad13 only and Dad13 along with infection. Salmonella infection (109 CFU/ml) was given once orally at week 4 to all groups except group treated with Dad13 only. The humoral immune response of Balb/C mice was detected 2 weeks after infection by measuring the titers of IgG and IgA specific from serum and mucosal intestinal liquid samples using Enzyme-linked Immunosorbent Assay (ELISA) method. The result indicated that humoral immune response of Balb/C mice consuming Dad13 before and along with Salmonella infection were significantly different (p<0.05). Dad13 consumption along with Salmonella infection increased circulated IgG and IgA as well as secretory IgA. It can be concluded that Dad13 probiotic feeding along with infection increased humoral immune response more significantly compared to that before infection.
oai:jurnal.ugm.ac.id:article/7562
2020-02-14T07:19:15Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7562
2020-02-14T07:19:15Z
Indonesian Journal of Biotechnology
Vol 11, No 1 (2006); 878-883
In vitro Antiplasmodial Activity and Cytotoxicity of Vincadifformine and Its Semisynthetic Derivatives
Original Research Articles
Mustofa, M.; Department Pharmacology & Toxicology and Center for Tropical Medicine, Faculty of Medicine,Gadjah Mada University, Yogyakarta 55281, Indonesia
Mallié, Michèle; Department of Immunology and Parasitology, Faculty of Pharmacy, University of Monpellier I
Valentin, Alexis; Department of Immunology and Parasitology, Faculty of Pharmacy, University of Monpellier I
Lewin, Guy; Department of Pharmacognocy, Center for Pharmaceutical Study, Châtenay Malabry, France
2006-06-01 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7562
vincadifformine - antiplasmodial – Plasmodium falciparum – cytotoxic - HeLa
en
An indole alkaloid with aspidospemane structure possessing a potential antiplasmodial activity, vincadifformine, has been isolated from Aspidosperma pyrifolium Mart. Moreover, 10 derivatives were prepared from the vincadifformine. The study was conducted to evaluate the in vitro antiplasmodial and cytotoxic activity of the vincadifformine and their semisynthetic derivatives. The in vitro antiplasmodial activity was evaluated on Plasmodium falciparum chloroquine-resistant (FcM29) and –sensitive (Nigerian) strains after 24-h and 72-h incubation, while cytotoxic activity was estimated on Hela cells and Cytotoxicity Index (CI = IC50 on HeLa cells/IC50 on FcM29 strain) was calculated to evaluate the safety of tested compounds. Experiment results showed that two compounds (4 and 8) exhibited good antiplasmodial activities in comparison with parent compound, vincadifformine and other tested compounds with IC50 ranging from 5.3 to 12.8 µM on FcM29 strain and 11.4 to 24.0 µM on Nigerian strain. In addition, the CI of two compounds were also lower after 24-h incubation (CI, 2.0 and 4.8) than that of after 72-h incubation (CI, 9.5 and 11.5). Further study will be conducted to evaluate quantitative structure-activity relationship (QSAR) in order to design new antimalarial drugs.
oai:jurnal.ugm.ac.id:article/7563
2020-02-14T07:19:15Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7563
2020-02-14T07:19:15Z
Indonesian Journal of Biotechnology
Vol 11, No 1 (2006); 889-893
Detection of eae, bfpA, espA Genes on Diarrhoeagenic Strains of Escherichia coli Isolates
Original Research Articles
Harti, Agnes Sri; Research Center for Biotechnology, Gadjah Mada University,Yogyakarta 55281, Indonesia.Faculty of Biology, Setia Budi University, Surakarta, Indonesia
Iravati, Susi; Department of Microbiology, Gadjah Mada University School of Medicine, Yogyakarta 55281,Indonesia
Asmara, Widya; Department of Microbiology, Faculty of Veterinary Medicine, Gadjah Mada University, Yogyakarta55281, Indonesia
2006-06-01 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7563
DNA probe, eae, bfpA, espA, EPEC
en
The Enteropathogenic Escherichia coli (EPEC) is one of pathogenic strain of diarrheagenic E. coli group in children and infant that occurs in developing countries. The significant virulence factors in pathogenic EPEC are eaeA (E. coli attaching- effacing ), bfpA (bundle-forming pilus A) and espA (encoding secreted protein A) genes. The use of DNA probes to detect the virulence genes in E. coli in Indonesia is not common yet. In this experiment the gene fragments of eae, bfpA, and espA were used as probes to detect the EPEC among E. coli isolates from stool specimensin of diarrheic children attending Public Health Centers in Yogyakarta. The DNA samples were isolated from 49 diarrheagenic E. coli isolates. The DNA probes of eae, bfpA and espA were obtained by amplification of DNA fragment of EPEC O126 using PCR technique. Furthermore, those probes were used to identify the presence of those genes among E. coli isolates using hybridization technique. The results showed that 42 (85.7%) isolates were espA+, 25 isolates (51%) were eaeA+ (EPEC strains). Therefore among 25 isolates of EPEC, 20 isolates (80 %) among EPEC were bfpA+ (typical EPEC strains).
oai:jurnal.ugm.ac.id:article/7564
2016-11-11T08:23:40Z
ijbiotech:ART
oai:jurnal.ugm.ac.id:article/7565
2019-08-27T08:06:22Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7565
2019-08-27T08:06:22Z
Indonesian Journal of Biotechnology
Vol 11, No 2 (2006)
The Efficacy of Fucoidan on Gastric Ulcer
Original Research Articles
Juffrie, Mohammad
Rosalina, Ina
Damayanti, Wahyu
Djumhana, Ali
Ariani, A.
Ahmad, Harjono
2006-12-01 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7565
Hyperacidity causes gastric injury, and in severe situations, ulcer could develop. The growth factors known asthe basic fibroblast growth factor (bFGF) and the epidermal growth factor (EGF) have been recognized to promoteulcer healing. Fucoidan is extracted from a brown seaweed of Okinawa called Mozuku or Cladosiphon okamuranus.Fucoidan is effective for the healing of gastric ulcers by inducing epithelial cells to produce growth factors. The aimof this study is to explore the efficacy of fucoidan in patient who suffered by gastric ulcer. A randomized control trialdouble blind was conducted to 33 eligible samples. By using four-blocks random samples were divided into fucoidanand placebo groups. 100 mg of fucoidan was given to the fucoidan group and 100 mg of glucose was given to theplacebo group. Due to ethical reasons, for both groups were given a proton pump inhibitor. There was no differencein the age category between the fucoidan group (mean: 46.23 ± 14.8 years) and the placebo group (mean: 46.18 ± 18.4years) (p: 0.28). There was also no difference in sex between the fucoidan group (female: 10/33; male 7/33) and theplacebo group (female: 7/33; male: 9/33); p: 0.38. According to the SAKITA and MIWA criterias 32 patients fulfilledA1 which indicate active severe ulcer, and 1 patient fulfilled A2 which indicate active moderate ulcer. Most of theulcers were gastric ulcer. There was a significant improvement of the grade of ulcer in fucoidan group (94%) (16/17)compared to placebo group (37.5%) (6/16,p: 0.005). There was a significant reduction of abdominal pain after 5 daysin the fucoidan group, compared to the placebo group (p: 0.04). Vomiting tends to decrease in day 6 of the fucoidangroup however its proportion is similar with that of the placebo group (p: 0.9). Fucoidan is effective for ulcer healingand reducing ulcer symptoms.Key words : fucoidan, gastric ulcer, anti-peptic activity
oai:jurnal.ugm.ac.id:article/7566
2019-08-27T08:06:22Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7566
2019-08-27T08:06:22Z
Indonesian Journal of Biotechnology
Vol 11, No 2 (2006)
Production and Extraction Of Antibacterial Bacteriocin from Pediococcus sp. NWD 015
Original Research Articles
Nofisulastri, N.
Bachruddin, Zaenal
Harmayani, Eni
2006-12-01 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7566
objectives were to study the growth pattern of Pediococcus sp. NWD 015 and bacteriocin activity, extractionand characterization of bacteriocin, and to determine the effect of storage time and temperature on bacteriocinactivity. Results showed that the bacteriocin activity increased during growth and reached the highest activity duringstationary phase. The maximum bacteriocin production reached after incubation of the cell for 12 h at 37oC in TGEbroth and decreased after 96 h incubation. Extraction with adsorbtion-desorbtion method could increased a specificactivity of bacteriocin. Bacteriocin from Pediococcus sp. NWD 015 is inactivated by Proteinase-K; however it is stillactive by heat treatment at 121oC for 15 min and over pH 2 – 11. Bacteriocin of Pediococcus sp. NWD 015 was effectiveagaints Enterococcus faecalis, Staphylococcus aureus, Eschericia coli, Listeria monocytogenes but not against Salmonellathypimurium. The molecular weight of bacteriocin is 4.95 kDa.Keywords : Bacteriocins, Pediococcus sp NWD 015.
oai:jurnal.ugm.ac.id:article/7567
2019-08-27T08:06:22Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7567
2019-08-27T08:06:22Z
Indonesian Journal of Biotechnology
Vol 11, No 2 (2006)
Molecular Study on The Pathogenicity of Avian Influenza Virus
Original Research Articles
Wibowo, Haryadi M.
Susetya, Heru
Untari, Tri
Putri, Khrisdiana
Tabbu, Charles Rangga
2006-12-01 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7567
Highly pathogenic avian influenza virus (HPAI) differ from Low pathogenic avian influenza virus (LPAI) basedon multiple basic amino acid motif of the carboxylterminus of HA1, especially arginine and lysine. The propose ofthis work was toamplify and sequence the cleavage site region of HA gene of avian influenza virusisolated from bothcases with characteristic or unspecific lesion, using reversetranscriptase polymerase chain reaction (RT-PCR). Primerdesaigned for amplification and sequence was H5-F: 5’ ggagactcagcaatcccatgaaaag 3’ and H5-R:5’ccataccaaccgtctaccattcc 3’, and expected product size was 246 bp. The result indicated that all avian influenzavirus (AIV)-isolates originated from chicken with both specific and non specific lesion show a multiple basic aminoacid motif -PQRERRRKKR//GLF- and classified as highly pathogenic avian influenza. Philogenetic study of HAgenefragment indicated that each type of characteristic lesion created philo-groups.Key words: avian influenza, lesion, hemagglutinin, cleavage site, phylogeny.
oai:jurnal.ugm.ac.id:article/7568
2019-08-27T08:06:22Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7568
2019-08-27T08:06:22Z
Indonesian Journal of Biotechnology
Vol 11, No 2 (2006)
Reactive Oxygen Intermediate (ROI) in Dog Macrophage Infected with Mycobacterium tuberculosis
Original Research Articles
Tjahajati, Ida
2006-12-01 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7568
experiment used 24 healthy dogs, aged between 1 and 2 years, both male and female which were divided into twodifferent groups consisting of 12 dogs each. The first group was the treatment group, that is they were infected with Mtuberculosis and the second one was the control group. The activity of macrophages ROI secretion were measured at1st, 2nd, 12th, and 24th after infection using nitroblue tetrazolium (NBT) reduction assay. Three cats were used to measure themacrophage activity in each period, using triplicate sample for each cat. The results of the experiment showed thatROI secretion increased in infected group compared with the control group, and this activity reached to the plateaulevel at 2 weeks after infection. Although these enhanced activities were gradually diminished thereafter, higherlevels of these activities were consistently observed until the end of experiment compared with control group. Theresults of the experiment indicated that ROI played an important role to against M.tuberculosis infection in dogs.Keyword: macrophage, ROI, M.tuberculosis, dogs
oai:jurnal.ugm.ac.id:article/7569
2019-08-27T08:06:22Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7569
2019-08-27T08:06:22Z
Indonesian Journal of Biotechnology
Vol 11, No 2 (2006)
Rapid Detection and Molecular Typing of Dengue Virus by Using Multiplex-Nested-RT-PCR
Original Research Articles
Wijayanti, Nastiti
Nirwati, Hera
Wibawa, Tri
Haryanto, Aris
Sutaryo, S.
2006-12-01 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7569
world. We have evaluated the combination of one-step RT-PCR and multiplex nested PCR assays for detectingdengue viruses from clinical samples. Twelve patients were screened for the dengue virus, using a pair of primersthat conserve for several Flavivirus. The results showed that in 12 suspect patients, 100% were positive for Flavivirusand there are some genotypic variation among them, that indicated by several RT-PCR products higher than 511 bp,the expected product for RT-PCR. Further assay was performed to clarify the presence and serotypes of dengue virususing multiplex nested PCR. Serotyping results indicated that 83,3% of samples can be confirmed for dengue virus.Among the dengue virus positive 16,7 % are dengue-2, 16.7 % are dengue-3, and the most common 50% are dengue-4,whereas dengue-1 were not found among the patients. The combination of RT-PCR and multiplex nested PCR assaycan be used for rapid analysis dengue samples in early phase which is potentially useful for clinical, epidemiologyand also evolutionary studies.Key words: Flavivirus, dengue virus, serotype, RT-PCR, multiplex nested PCR
oai:jurnal.ugm.ac.id:article/7570
2019-08-27T08:06:22Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7570
2019-08-27T08:06:22Z
Indonesian Journal of Biotechnology
Vol 11, No 2 (2006)
Apoptosis and Phagocytosis Activity of Macrophages Infected by Mycobacterium tuberculosis Resistant and Sensitive Isoniazid Clinical Isolates
Original Research Articles
Rachmawaty, Farida J.
Wibawa, Tri
Soesatyo, Marsetyawan H.N.E.
2006-12-01 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7570
Mycobacterium tuberculosis (M.tb) is the main causative pathogen that cause the pulmonary tuberculosis.Intracellular M.tb was reported able to induce macrophages apoptosis, which may have crucial role in the regulationof immun response against M.tb infection. As an intracellular bacteria, M.tb able to live and replicate withinmacrophages. Phagocytosis is the first step to achieved this condition. The induction of macrophages apoptosis byINH resistant and sensitive M.tb clinical isolates, and H37Rv was studied. The macrophages apoptosis level weremeasured using an Ag-capture ELISA for histone and fragmented DNA (Cell Death Detection ELISAplus, RocheDiagnostic GmBH). Phagocytosis activity also analyzed, after staining using fluorescence dye (AcriFluorTM, ScientificDevice Lab.). The results showed that there was no significantly different between INH resistant and sensitive M.tbclinical isolates in respect their ability to induce apoptosis. The phagocytosis activity among the clinical isolates wasshown to be strain dependent, and undistinguishable between the Mtb clinical isolates. There was no associationbetween macrophages apoptosis level and the phagocytosis activity. These data suggested that among the virulentMtb clinical isolates, the ability to induce macrophages apoptosis and phagocytosis were consistently in comparablelevelKeywords: Mycobacterium tuberculosis, apoptosis, phagocytosis, macrophages, isoniazid
oai:jurnal.ugm.ac.id:article/7764
2018-09-22T17:52:24Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7764
2018-09-22T17:52:24Z
Indonesian Journal of Biotechnology
Vol 12, No 1 (2007)
Effect of Culture Medium Supplementation with b-mercaptoethanol and Amino Acid on Canine Intergeneric Embryo Development with Porcine Oocyte Cytoplasm Recipient
Original Research Articles
Fibrianto, Yuda Heru
2007-06-06 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7764
The present study investigated the effect of culture medium supplementation with mercaptoethanol ( ME)and amino acid (AA) on canine intergeneric embryo development with porcine oocyte cytoplasm. Porcine cumulusoocyte complexes (COCs) were collected from slaughterhouse and matured in TCM-199 supplemented with 26.2mM NaHCO, 3.05 mM glucose, 0.91 mM sodium pyruvate, 0.57 mM L-cysteine, 75 mg/l kanamycin, 10 ng/ml 3epidermal growth factor, equine chorionic gonadotropin (eCG), 10 IU/ml human chorionic gonadotropin (hCG),and 10% (v/v) porcine follicular fluid (pFF) at 39 °C in a humidified atmosphere of 5% CO for 42-44 h and donor cell 2collected from ear skin afghanhound male dog. After somatic cell nuclear transfer (SCNT), embryo developmentwere examined for cleavage rate and 144 hr for final development after cultured in media. The result shows that,amino acid and mercapoethanol addition in culture medium (NCSU-23) have no effect on embryo development.The development rate of embryo until 16 cell stage in NCSU and NCSU supplement are 4.67% and morula stage are3.73% and 4.67%.Key words : intergeneric clone embryo, canine, ( amino acid (AA)
oai:jurnal.ugm.ac.id:article/7765
2018-09-22T17:52:24Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7765
2018-09-22T17:52:24Z
Indonesian Journal of Biotechnology
Vol 12, No 1 (2007)
Biochemival Characterization of an Antibactrial Glycoprotein from Achatina fulica ferussac Snail Mucus Local Isolate and Their Implication on Bacterial Dental Infection
Original Research Articles
Berniyanti, Titiek
Waskito, Edy Bagus
Suwarno, S.
2007-06-06 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7765
Snails crawl over a variety of potentially contaminated surfaces and their foot is the primary site of entry forpathogens, parasites and a range of opportunistic organisms, so it is a little wonder that they must have a defensivesystem to protect them. The mucus secreted on the body surfaces of mollusks is known to play crucial role inlocomotion, feeding, osmoregulation, reproduction and protection of epithelial surfaces. The snail mucus alsocontains Glycoaminoglycans (GAGs) which are complex polysaccharides that participate in the regulation ofphysiological processes through the interactions with a wide variety of proteins. GAGs, such as heparin, serve as keyto biological response modifiers, in example for acting asa a target for pathogen and parasitic factors for attachment,invasion, and immune system.For years, it has been known that the mucus secretions from snails Achatina fulica ferussac local isolate can be usedas a medication, and even empirically it is used to treat infected teeth tahat is suffered by people in rural area. Theantibacterial factor was surveyed in the aqueous extract and the mucin fraction of snail Achatina fulica ferussac, andthey exhibited positive antibacterial for Gram-positive, Escherichia coli and Gram negative, Streptococcus mutans. Inthe following study, it has been proved that an antibacterial content in the mucus was a Glycoprotein. It wascomposed of two subunits of Molecular Weight (MW) 71-73 kDa. The GelCode Glycoprotein Staining Kit detectedglycoprotein sugar moieties in polyacrylamide gel and on nitrocellulose membrane, while the glycoproteincarbohydrate estimation kit detected glycoprotein and estimated carbohydrate content. The glycoprotein contentwas 4.537 ± 0.876 for carbohydrate and 6.420 ± 1.242 for protein.Keywords : characterization, glycoprotein, Achatina fullica Ferussac snail mucus, galur Jawa, antibacterialfactor
oai:jurnal.ugm.ac.id:article/7766
2018-09-22T17:52:24Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7766
2018-09-22T17:52:24Z
Indonesian Journal of Biotechnology
Vol 12, No 1 (2007)
Alternative Oxidase (AtAox) c78s Mutant Expression at Escherichia coli (SASX41DB)
Original Research Articles
Djajanegara, Ira
2007-06-06 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7766
Alternative oxidase (AOX) is the terminal oxidase operating in the mitochondrial electron transport chain. Theenzyme is activated by organic acid such as pyruvate and by reduction process. Based on sequences alignment ofalternative oxidase gene (Aox) found in several organisms, there are 2 conserved cysteine residues. In order toinvestigate the importance of those cysteine residues on the activity of AOX, mutation at cysteine residue number 78of Aox gene isolated from Arabidopsis thaliana (AtAox) was conducted. Cysteine at position number 78 was changedinto serine and the c78s mutant was expressed in Escherichia coli strain SASX41DB. This particular E. coli strain isunable to grow aerobically unless transformed with Arabidopsis Aox gene (AtAox). Expression studies on c78smutant showed that this mutant cannot be oxididized and can not be activated by pyruvic acid. This mutant isacivated by succinate instead of pyruvate. Mutation at cysteine closer to the N residue is affecting both organic acidand redox activation. Therefore, it is concluded that cysteine residue closer to the N residue is the site for bothactivation by pyruvate as well as activation by reduction process.Keywords : Alternative oxidase, site-directed mutation, SASx41DB, cysteine residues
oai:jurnal.ugm.ac.id:article/7767
2018-09-22T17:52:24Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7767
2018-09-22T17:52:24Z
Indonesian Journal of Biotechnology
Vol 12, No 1 (2007)
Effect of Staurosporine on the Intracellular Localization of Hepatitis B Virus Core Protein
Original Research Articles
Haryanto, Aris
Wijayanti, Nastiti
Kann, Michael
2007-06-06 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7767
protein is also including in the HBV genome targeting into the nucleus through modulating carboxyl residues byphosphorylation. Nuclear localication Signal (NLS) in HBV core protein is inside the virion structure and it must beunmasked in order to function, perhaps by phosphorylation. Phosphorylation of of HBV core protein in turn couldbegin to alter capsid conformation. Staurosporine is a natural product originally isolated from bacteriumStreptomyces staurosporeus. Staurosporine was discovered to have biological activities ranging from anti-fungal toanti-hypertensive. The interest in these activities resulted in a large investigative effort in chemistry and biology andthe discovery of the potential for anti-cancer treatment. The main biological activity of Staurosporine is the inhibitionof protein kinases through the prevention of ATP binding to the kinase. In the present study, we have studied theintracellular localization of EGFP-Core fusion protein with triple HBV core and SV-40 nuclear localization signal atits carboxyl terminal in presence and absence of Staurosporine. We also to study the effect of Staurosporine treatmenton the intracellular localization of EGFP-Core fusion protein in the hepatocyte cells line of HepG2 cell. Resultsshowed that effect of Staurosporine is prevent the nuclear localization of EGFP-Core fusion protein into nucleusthrough an inhibition of the phosphorylation of core protein. Stauroporine also prevents cell division so that passivetrapping of core protein is inhibited.
oai:jurnal.ugm.ac.id:article/7768
2018-09-22T17:52:24Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7768
2018-09-22T17:52:24Z
Indonesian Journal of Biotechnology
Vol 12, No 1 (2007)
Superoxide Dismutase of Micrococcus sp. S2 and Its Involve in Paraquat Detoxification
Original Research Articles
Margino, Sebastian
Martani, Erni
Magdalena, Medhina
2007-06-06 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7768
As an active ingredient of herbicide, paraquat will induce formation of superoxide radicals. The previousresearch succeeded in isolating paraquat degrading bacteria from peat soil, Micrococcus sp. S2, that tolerant to highconcentration of paraquat. An anti-oxidative enzyme, namely superoxide dismutase (SOD, EC.1.15.1.1), wasbelieved to be responsible for the paraquat tolerance. This research was conducted to study the characteristic of theSOD synthesize by Micrococcus sp. S2 and its ability on neutralize superoxide which arise from paraquat reoxidation.To observe the effect of paraquat on Micrococcus sp. S2, the bacteria was grown in 10% Luria Bertani brothmedium amended with several concentrations of paraquat, from 0 (control) up to 100 mg/ml. Within incubationtime of 72 hours, bacterial growth, activity of superoxide dismutase and paraquat residue were analyzed. Theisozymes of superoxide dismutase were distinguished using two kinds of specific inhibitor, namely HO and KCN. 2 2The results showed that paraquat significantly inhibit the growth of Micrococcus sp. S2. The higher paraquatcocentration in the medium caused the higher growth inhibition. However, the bacteria is still survive in the mediumcontaining toxic herbicide, and this ability was suggested related to superoxide dismutase activity in removing thesuperoxide radicals. Analysis using gel electrophoresis indicated that at least three types of SOD isozyme weresynthesized by Micrococcus sp. S2; they were Ferri-SOD (Fe-SOD), Mangani-SOD (Mn-SOD), and the last one wassuspected to be the Cupro Zinc-SOD (CuZn-SOD). The Mangani-SOD was suspected to play an important roles ondetoxifying superoxide which arise from paraquat oxidation.Keywords : Micrococcus sp.S2, paraquat, superoxide dismutase, isozymes
oai:jurnal.ugm.ac.id:article/7769
2018-09-22T17:52:24Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7769
2018-09-22T17:52:24Z
Indonesian Journal of Biotechnology
Vol 12, No 1 (2007)
Genetic Heterogenity Profile of Penaeus monodon Broodstock F1 Revealed by Mitochondria DNA-RFLP and RAPD
Original Research Articles
Prastowo, Bambang Widyo
Rahardianti, Rahayu
Nur, Evi Maftuti
Taslihan, Arief
2007-06-06 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7769
The genetic heterogeneity of Penaeus monodon broodstock F1 was evaluated using Restriction Fragment LengthPolymorphism (RFLP-mtDNA) and Random Amplified Polymorphic DNA (RAPD) analysis. The RFLP analysis wasconducted by amplifying 16SrDNA region and digested with restriction enzyme Nde II. According to the RFLPanalysis, heterogeneity value of P. monodon F1 broodstock population is 0,0422; male F1 population is 0,0613 andfemale F1 population is 0,1252. The primer OPA2 was used in RAPD analysis. According to the RAPD analysis,heterogeneity value of P. monodon F1 broodstock population is 0,0417; male F1 population is 0,0653 and female F1population is 0,1104. The results of this research showed that either RFLP or RAPD can be used as a family specificmarker for Penaeus monodon.Key words : Penaeus monodon, RFLP, RAPD, heterogeneity, genetic marker
oai:jurnal.ugm.ac.id:article/7771
2018-09-22T17:55:36Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7771
2018-09-22T17:55:36Z
Indonesian Journal of Biotechnology
Vol 12, No 2 (2007)
Phenotype of Transgenic Tobacco Plants (Nicotiana tabacum cv. Petit Havana SR-1) Expressing 1724orf13 Gene of Agrobacterium rhizogenes strain MAFF301724
Original Research Articles
Handayani, Niken Satuti Nur
Tanaka, Nobukazu
Yoshida, Kazuo
2007-12-09 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7771
Nicotiana tabacum cv. Petit Havana SR-1 transgenic plants expressing ORF13 of Agrobacterium rhizogenes strainMAFF301724 under different promoters displayed plant morphology abnormalities. They were small, with shortand variable internodes lengths; leaves were small, asymmetric, rounded, wrinkled and dark green; flowers wereshort, and irregularly shaped. This phenotype was also exhibited, similar, but not completely the same, to those ofhairy root syndrome, indicating that expression of ORF13 influences plant development.Keywords: ORF13, Agrobacterium rhizogenes strain MAFF301724, transgenic plants, morphology abnormalities
oai:jurnal.ugm.ac.id:article/7772
2018-09-22T17:55:36Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7772
2018-09-22T17:55:36Z
Indonesian Journal of Biotechnology
Vol 12, No 2 (2007)
Combination Methods for Screening Marine Actinomycetes Producing Potential Compounds as Anticancer
Original Research Articles
Farida, Yuyun
Widada, Jaka
Meiyanto, Edy
2007-12-09 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7772
Marine actinomycetes is a robust source of secondary metabolites including anticancer compounds . The objective of this research was to select marine actinomycetes producing potential compounds as anticancer used combination methods that consist of amplification PKS I (polyketide synthases type I) and NRPS (non ribosomal peptide synthetases) genes, analysis the diversity of secondary metabolites and genetic. Selected isolates were used for cytotoxicity assay. PKS I and NRPS genes were amplified using sets of degenerate primers. K1F and M6R were used for amplify ketosynthase and methyl-malonyl-CoA transferase modules of PKS I gene which targeted sequences 1200-1400 bp. A3F and A7R were used for amplify adenilation domains of NRPS gene which targeted sequences 700-800 bp. The diversity of secondary metabolites was analized by TLC and densitometry of ethyl acetate extracts. Genetic diversity was analized by repetitive DNA fingerprinting using BOXA1R primers. The cytotoxicity of secondary metabolites on T47D and MCF7 breast cell lines cancer was measured by MTT assay method. Fifty two marine actinomycetes isolates were screened using combination methods. Ten isolates were detected encoding both PKS I and NRPS genes, whereas 11 isolates were detected encoding the NRPS gene. The screening by analysis of secondary metabolites and genetic diversity methods were obtained 6 selected isolates for cytotoxicity assay, which consist of 3 isolates encoding both PKS I and NRPS genes and 3 isolates encoding NRPS gene.Isolate 1 had high cytotoxicity with the IC50 on T47D cell was 19 &mu;g/ml and the IC50 on MCF7 cell was 7 g/ml. This findings suggests that combination methods were effective and efficient way to select marine actinomycetes producing potential compounds as anticancer.
oai:jurnal.ugm.ac.id:article/7773
2018-09-22T17:55:36Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7773
2018-09-22T17:55:36Z
Indonesian Journal of Biotechnology
Vol 12, No 2 (2007)
The Use of Genetic Variability Analysis of Fusarium oxysporum f. sp. cubense for Breeding Resistance of Banana against Fusarium Wilting Disease
Original Research Articles
Ruhana, Faria
2007-12-09 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7773
Fusarium wilting on banana crop caused by Fusarium oxysporum f. sp. cubense is one of the important disease in banana plant in Indonesia. This disease can cause plant to wilt and die, therefore bringing loss to the banana farmer and entrepreneur. F. oxysporum f. sp. cubense genetic variability analysis techniques can be done by in vitro or in vivo. One of F.oxysporum f. sp. cubense genetic variability analysis techniques by in vitro is RAPD-PCR. In this research, analysis is continued with pathogen test. Genetic variability analysis by in vivo is needed to determine the level of pathogen and the race. The result of genetic variability techniques by RAPD-PCR done by this writer indicates that there is a big relation/link difference between isolats from different island. Isolat from Mojokerto (East Java) is 100% genetically different compared to the one from West Sumatera. Later, result of pathogen test shows that Pisang Ambon Kuning is the most resilient compared to Pisang Raja and William Cavendish. Based on the level of pathogen, there are two race grouping, which are race 1 that attacks Pisang Ambon Kuning and race 4 that attacks Pisang Raja and William Cavendish. Scott-Knott analysis on 26 isolats results in no real difference between isolats tested.
oai:jurnal.ugm.ac.id:article/7774
2018-09-22T17:55:36Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7774
2018-09-22T17:55:36Z
Indonesian Journal of Biotechnology
Vol 12, No 2 (2007)
A Single Base Substitution Adjacent to the Stop Codon in the downstream of the SMP3 gene Affects its Post-trancriptional process in Saccharomyces cerevisiae
Original Research Articles
Widianto, Donny
Mukai, Yukio
Irie, Kenji
Araki, Hiroyuki
Oshima, Yasuji
2007-12-09 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7774
The smp3-1 mutant allele confers increased holding stability of heterologous plasmid, pSR1, and a temperature-sensitive growth defect which is remediable by the addition of 1 M sorbitol as the osmotic stabilizer. The smp3-1 allele contains two base substitutions; one is in the open reading frame and changed the 490th CAT (encoding Histidine) to TAT (tyrosine), and the other one is an A for G substitution, at 2 bp downstream from termination codon. These base substitutions were separated each other by recombination at a BstNI site located between these two substitutions. The base substitution in the 3'' untranslated region was found to be lethal and the defect was unremediable by the osmotic stabilizer, while that in the open reading frame has no appreciable effect to the cell. Thus, both the base substitutions join together confer the smp3-1 mutant phenotype. The smp3-1 mutant cells cultivated at 37 OC in nutrient medium containing 1 M sorbitol showed similar smp3 transcription as in the wild type. These facts suggest that smp3-1 mutation has a defect in its post-transcriptional process.
oai:jurnal.ugm.ac.id:article/7775
2018-09-22T17:55:36Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7775
2018-09-22T17:55:36Z
Indonesian Journal of Biotechnology
Vol 12, No 2 (2007)
Effect of the HBV Capsid Assembly Inhibitor Bayer 41-4109 on the Intracellular Localization of EGFP-Core Fusion Proteins
Original Research Articles
Haryanto, Aris
Wijayanti, Nastiti
Kann, Michael
2007-12-09 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7775
Bayer 41-4109 is heteroarylpyrimidine (HAP) which has been identified as potent of HBV capsid assemblyinhibitor. The present study was to study effect of Bayer 41-4109 treatment on the intracellular localization ofEGFP-Core fusion proteins into HepG2 cells. Three recombinant plasmids of pEGFP-Core with single, double andtriple NLS of HBV core (EGFP-Core 1C, 2C and 3C ) and two recombinant plasmids with single and triple NLS ofSV-40 (EGFP-Core 1 and 3 SV-40) were used in this work. After transient transfected into HepG2 cells and treatedwith Bayer 41-4109, the intracellular localization of expressed fusion proteins from all plasmid constructions weredetermined and quantified under confocal laser microscope. Results shown that Bayer 41-4109 treatment in HepG2cells inhibited the nuclear localization of EGFP-Core with single of triple HBV core NLS. As well as the constructionsof expressed fusion protein with single and triple SV-40 NLS (EGFP-Core 1 and 3 SV-40 NLS) showeddecreasing the nuclear localization after treated with Bayer 41-4109, even not as strong as EGFP-Core 1C and 3CNLS. Bayer 41-4109 has been identified as a potent inhibitors of HBV replication which has multiple effects on HBVcapsid assembly. It may inhibit virus replication by inducing assembly inappropriately and by misdirectingassembly decreasing the stability of normal capsids.Keywords: HBV capsid, Bayer 41-4109, EGFP-Core fusion protein, HepG2 cell
oai:jurnal.ugm.ac.id:article/7776
2018-09-22T17:55:36Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7776
2018-09-22T17:55:36Z
Indonesian Journal of Biotechnology
Vol 12, No 2 (2007)
T47D cells arrested at G2M and Hyperploidy Formation Induced by a Curcumin’s Analogue PGV-1
Original Research Articles
Da’i, Muhammad
Jenie, Umar Anggara
AM, Supardjan
Kawaichi, Masashi
Meiyanto, Edy
2007-12-09 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7776
its chemical structure than curcumin. As a curcumin analogue, PGV-1 was considered to have anticanceractivities. This research was conducted to study the effect of PGV-1 on the cycle progression of T47D cells. Cytotoxiceffects of PGV-1 on T47D cells were determined using MTT assay, and the the effect on cell cycle progressionwas carried out using flowcytometry. Western blot analysis was used to analyze protein expression correspondingto cell cycle progression. The result showed that at the concentration of 2.5 μM PGV-1 inhibited cell cycleprogression through G2/M arrest and induced of cells hyperploidy formation. The hyperploidy formation inducedby PGV-1 was related to the increase of cdc-2 expression. PGV-1 2.5 μM elevated the level of p21 CIP/KIPthrough p53- independent manner. Apoptosis was also induced by PGV-1 at early phase of treatment indicated byPARP cleavage due to activation of caspase-3/7 after 12 h treatment. The results above suggest that PGV-1 inhibitsthe growth of T47D cells targeted on microtubules.Keywords: PGV-1, G2/M arrest, apoptosis, p21
oai:jurnal.ugm.ac.id:article/7792
2018-09-22T17:56:35Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7792
2018-09-22T17:56:35Z
Indonesian Journal of Biotechnology
Vol 13, No 1 (2008)
Epitope Mapping of Fc gamma RIIa Monoclonal Antibodies
Original Research Articles
Sardjono, Caroline Tan
Wines, Bruce
Powel, Maree
Hogarth, Mark
2008-06-01 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7792
Fc&gamma;RIIa (CD32) is an IgG receptor which has been shown to be important in autoimmune disease pathology. IV.3, 8.7, and 7.30 are anti-Fc&gamma;RIIa monoclonal antibodies (mAbs), which block the interaction between Fc&gamma;RIIa and complex IgG. In this study, the three mAbs were demonstrated to inhibit Fc&gamma;RIIa function. The determination of the precise epitopes of the IV.3, 8.7, and 7.30 mAbs may become a potential approach for designing inhibitors for Fc&gamma;RIIa. The epitope of IV.3, 8.7, and 7.30 were determined using chimeric receptors based on the extracellular domains of Fc&gamma;RIIa and the Fc&epsilon;RI a chain. The epitopes for IV.3 was found to be mapped on amino acid residues 132-137, while 8.7 and 7.30 were on amino acid residues 112-119 and 157-162. Based on the crystal 3D model of Fc&gamma;RIIa molecule, these amino acid sequences are clustered together forming a contiguous region within the ligand binding site of the receptor.
oai:jurnal.ugm.ac.id:article/7793
2018-09-22T17:56:35Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7793
2018-09-22T17:56:35Z
Indonesian Journal of Biotechnology
Vol 13, No 1 (2008)
Cortisol and Estradiol Profile in Cross-bred Ettawa Does: The Effects of Body Condition Scoring (BCS).
Original Research Articles
Astuti, Puji
Widayati, D. Tri
Sunendar, S.
Suharto, K.
Kusumawati, Asmarani
Junaidi, A.
2008-06-01 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7793
Body Condition Scoring (BCS) is an estimation of the muscle and fat development of an animal. Thin ewes that are fighting to maintain their own body weight and low concentration of cortisol are not able to ovulate as ewes in a more desirable condition due to lack of oestradiol concentration. The aims of this research are to monitor the cortisol and oestradiol profile in Cross-bred ettawa does and to determine effect of BCS on the cortisol and oestradiol profile. Eight does were used in this research. These animals were devided equally into 2 groups based on Body Condition Scoring (BCS), namely BCS 2, which body weight range between 25-30 kgs as group I ( >n=4 ) and BCS 3 which consists of ettawa with body weight range between 33-40 kg as group II ( n=4 ). All animals were synchronized using implant of CIDR and PGF2alpha. Blood from jugular vein were collected every 3 and 6 hours as soon as oestrus until 72 hours. Serum contained cortisol and oestradiol then assayed using ELISA</div><div>method. Cortisol and oestradiol concentrations were compared between groups by T test. The results showed that average concentration of cortisol is 47.17 &plusmn; 42.19 ng/mL for BCS 2 and 112.40&plusmn;74.41ng/mL for BCS 3 (P&lt;0.05), whereas concentration of oestradiol is 72.25&plusmn;30.62 pg/mL for BCS 2 and 145.72&plusmn;100.18 pg/mL for BCS 3 (P&lt;0.05). Either cortisol or oestradiol have very synchronized wave except 2 of animals from BCS 2 (50%), which has tendency to suppress each other. It was concluded that profile of cortisol and oestradiol hormone have a very similar pattern, and BCS can affect hormone profile.
oai:jurnal.ugm.ac.id:article/7794
2018-09-22T17:56:35Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7794
2018-09-22T17:56:35Z
Indonesian Journal of Biotechnology
Vol 13, No 1 (2008)
Identification of Thymocyte Subset by Multicolor Flow Cytometry ED LSR II FACSDriva - FlowJo Software Analysis
Original Research Articles
Harapan, H.
Wienands, W.
Ichsan, I.
Indrayati, Ana
2008-06-01 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7794
In their development, thymocytes express different cell surface molecules that important for identification of thymocyte subset. It&rsquo;s not easy to detect this cell surface molecules to determine the thymocyte subpopulation for research. Here we used multicolor flow cytometry ED LSR II FACSDriva - FlowJo software to identify of thymocyte subset from thymocyte sample solution using several antibodies such as mouse anti rat CD2-FITC, mouse anti rat CD45RC-PE, mouse anti rat CD4-APC, mouse anti rat CD8&aacute;-PerCP, mouse anti rat CD3-Biotin + PE-Cy7 or APC-Cy7. We determined double negative and single positive thymocyt subset (CD4 or CD8), found that the double negative thymocyte subset express CD2 and CD45RC. It was useful to determine the thymocyte subset using multicolor flow sitometry ED LSR II FACSDriva - FlowJo software.
oai:jurnal.ugm.ac.id:article/7795
2018-09-22T17:56:35Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7795
2018-09-22T17:56:35Z
Indonesian Journal of Biotechnology
Vol 13, No 1 (2008)
Cloning and Sequencing cDNA Encoding for Rhoptry-2 Toxoplasma Gondii Tachyzoite Local Isolate
Original Research Articles
Murwantoko, M.
Widada, Jaka
Nuraini, Yani Lestari
2008-06-01 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7795
Rhoptry protein belongs to an excretory and secretory antigens (ESAs) that play an important role during active penetration of parasite into the cell target. This protein an able Toxoplasma gondii to actively penetrate targeted cell, meanwhile ESAs protein stimulates intracellular vacuole modification. It is, therefore, after the parasite successfully enter the cell target then Granule (GRA) proteins are responsible for the formation of parasitophorus vacuole, which is protect the fusion with other intracellular compartments such as lysosomal vacuole. Consequently, this parasite is being able to survive and multiply at the cell target. The current study was aimed to clone and sequens cDNA encoding for ROP-2 of local isolated T. gondii tachizoite through DNA recombinant technique. Total ribonucleic acid (RNA) was isolated from tachyzoites of local isolated T. gondii that were grown up in Balb/c mice. Messenger RNA was isolated from total RNA using PolyAtract mRNA Isolation System. Messenger RNA was used as a template for synthesis cDNA using Riboclone cDNA Synthesis System AMV-RT. EcoRI adaptor from Riboclone EcoRI Adaptor Ligation System was added to Complementary DNA and than ligated to pUC19. Recombinant plasmid was transformed into E. coli (XL1-Blue). The transformed E. coli XL-1 Blue were plated on LB agar containing X-Gal, IPTG and ampicillin. Recombinant clones (white colony) were picked up and grown up in the LB medium at 37oC overnight. Expression of recombinant protein was analysed by immunoblotting in order to identify cDNA recombinant wich is express ESA of T. gondii local isolate. Recombinant plasmid were isolated using alkalilysis method and were elektroforated in 1% agarose gel. The isolated DNA recombinant plasmid was cut using Eco RI and then sequenced through Big Dye Terminator Mix AB1 377A Sequencer using M13 Forward and M13 Reverse primers. The conclusion of this results showed that the recombinant clone was coding for excretory and secretory protein which has molecular weight of 54 kDa. The DNA alignments of sequence from the cloned gene showed 97% homology with gene encoding for ROP-2 of T. gondii RH isolate.', 'string'),(99, 'en_US', 'subject', 'Toxoplasma gondii, tachizoite, ESA, complementary DNA, ROP2
oai:jurnal.ugm.ac.id:article/7796
2018-09-22T17:56:35Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7796
2018-09-22T17:56:35Z
Indonesian Journal of Biotechnology
Vol 13, No 1 (2008)
PGV-1 is a Potent Antimitotic Agent
Original Research Articles
Widaryanti, Barinta
Da’i, Muhammad
Kawaichi, Masashi
2008-06-01 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7796
Carcinogenesis may resulted from the malfunctioning of programmed cell death. Most of the anticancer drugs incurrent use induce apoptosis in susceptible cells. The fact that disparate agent interacting with different targets seemto induce cell death through some common mechanisms suggest that anticancer activity is determined by the abilityof inhibiting cell growth. Pentagamavunon-1 (PGV-1) is one of the curcumin analogues which showed to havepotency in inhibiting proliferation of T47D human breast carcinoma cells. The effects on T47D cells growth isassociated with cell cycle arrest in G2/M phase at the concentration of 2.5 ?M, followed by hyperploidy. The data onpolymerization assay, indicated that PGV-1 interact with tubulin in different manner from taxol. PGV-1 inhibittubulin polymerization on cell culture while taxol stabilized tubulin polymerization. Immunostainning data onPGV-1 treated cells showed slightly tubulin condensation, while taxol treated cells showed tubulin condensationdistinctly at 12 minutes after releasing from depolymerizing agent.In conclusion, PGV-1 represent a new microtubule inhibitor and has the potential to be developed for antimitoticdrugKey words: Pentagamavunon-1, T47D, tubulin
oai:jurnal.ugm.ac.id:article/7797
2018-09-22T17:56:35Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7797
2018-09-22T17:56:35Z
Indonesian Journal of Biotechnology
Vol 13, No 1 (2008)
Actin Distribution in Lamina Neuralis During Cranial Neurulation of Wistar Rats Embryo (Rattus rattus)
Original Research Articles
Prahastuti, Indriayuni
Issoegianti R., S.M.
2008-06-01 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7797
such as craniorachisis and exencephaly. One of the processes is changing in lamina neuralis cells shape, which iscaused by actin microfilament rearrangement within lamina neuralis cells. To examine the distribution of actinmicrofilament during cranial neurulation Wistar rats embryo were used. Embryos were obtain at following days ofdevelopment; 8 days 18 hours, 9 days, 9 days 6 hours, 9 days 12 hours, 9 days 18 hours, and 9 days 20 hoursrespectively. Immunohistochemistry Avidin Biotin-peroxidase Complex (ABC) method was used to examine andidentify the distribution of actin in lamina neuralis cells. Light microscopic observation shows positive reaction foractin immunoreactivity in the apical surface of bending lamina neuralis cells. In contrast, actin is not observed in nonbendinglamina neuralis. Actin is not detected at 8 days 18 hours embryos. At 9 days embryos, positive reaction isobserved over the entire apical surface of lamina neuralis.Key words: Cranial neurulation, Actin, lamina neuralis, Rats embryo.
oai:jurnal.ugm.ac.id:article/7798
2018-09-22T17:57:58Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7798
2018-09-22T17:57:58Z
Indonesian Journal of Biotechnology
Vol 13, No 2 (2008)
Nuclear Maturation of Porcine Oocytes in vitro: Effect of the Cumulus-Oocyte Complexes Quality
Original Research Articles
Karja, Ni Wayan Kurniani
2008-12-05 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7798
The objective of this study was to examine the effect of the cumulus-oocyte complexes (COCs) quality on the ability of porcine oocytes to mature in vitro. Porcine COCs were collected from 2-6 mm follicles of slaughterhouse ovaries. The oocytes used for IVM were classified into three categories based on the compactness and transparency of the cumulus investment and homogeneity and transparency of the ooplasm. The oocytes were then matured in vitro for 44 h. At 22 of maturation culture, most of the oocytes in all</div><div>groups were identified still at germinal vesicle (GV) stage and metaphase I (M-I) stage. After 44 h of culture, a greater proportion of Category I and II oocytes completed in vitro maturation through the second meiotic as compared with that of Category III oocytes (P&lt;0.05). The proportion of oocytes remaining at M-I stage and the degenerative oocytes in Category III oocytes were significantly higher than those of oocytes in other groups (P&lt;0.05). These data indicate that porcine oocytes with high quality cytoplasm and a cumulus cell complement have a much greater chance of maturing in vitro than that lower quality oocytes. The morphological grading of immature oocytes is an appropriate selection criterion for their developmental ability.
oai:jurnal.ugm.ac.id:article/7799
2018-09-22T17:57:58Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7799
2018-09-22T17:57:58Z
Indonesian Journal of Biotechnology
Vol 13, No 2 (2008)
Succession of Actinomycetes During Composting Proccess of Dairy-Farm Waste Investigated by Culture-Dependent and Independent Approaches
Original Research Articles
Faatih, Mukhlissul
Widada, Jaka
Ngadiman, N.
2008-12-05 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7799
Mesophilic, thermophilic, and maturation phases were recognized in composting proccess. Temperaturechanges influence the microbial communities in compost within composting proccess. Actinomycetes account for alarger part of compost microbial population. The aim of this research was to study succession of actinomycetescommunity during composting of dairy-farm waste investigated by culture-dependent and independentapproaches.In culture-independent method, the succession of actinomycetes community was analyzed by nestedpolymerasechain reaction of ribosomal intergenic spacer (nested-PCR RISA) using spesific primer F243 and primerR23S followed by a second PCR using primers F968 and R23S. In culture-dependent method actinomycetes fromcompost were isolated on selective media, starch-nitrate medium and humic-acid + vitamins medium. DNA ofactinomycetes was extracted and amplified by repetitive sequence-based PCR (rep-PCR) using primer BOXA1R. Thebanding patterns were used to generate dendrograms by UPGMA clustering with NTSYS program. Microcosmcontaining sterile rice-straw and water which is inoculated with each actinomycetes isolates was used for examiningthe ability of each isolate in rice-straw degradation.The experiment results showed that succession of both bacteria and actinomycetes was occured withincomposting proccess of dairy-farm waste. Analysed by culture-independent method revealed that the highestcommunity of compost’s bacteria was on mesophilic, thermophilic, and maturation phases, respectively. WhereasPCR-nested RISA resulted the highest population of actinomycetes was on thermophilic, maturation, and mesophilicphases, respectively. By culture-dependent method was obtained 29 actinomycetes isolates from mesophilic phase,23 isolates from thermophilic phase, and 19 isolates from maturation phase. Genetic diversity analysis of the obtainedisolates showed the presence of phylogenetic grouping on each phase of composting proccess. This result illustratedthe occurance of succession of actinomycetes community in compost. The ability of each isolates in rice-strawdegradation was different, and SnT9 isolate was found to be a promising rice-straw degrader.Keywords: succession, actinomycetes, composting, nested-PCR RISA, rep-PCR
oai:jurnal.ugm.ac.id:article/7800
2018-09-22T17:57:58Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7800
2018-09-22T17:57:58Z
Indonesian Journal of Biotechnology
Vol 13, No 2 (2008)
Citrus reticulata's Peels Modulate Blood Cholesterol Profile and IncreaseBone Density of Ovariectomized Rats
Original Research Articles
Adelina, Rosa
Supriyati, Maria Dwi
Nawangsari, Dwi Ana
Jenie, Riris I
Meiyanto, Edy
2008-12-05 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7800
Hormon Replacement Therapy is a common therapy for estrogen deficiency but in other side it will increase the risk of cardiovascular disease. Another alternative therapy which relatively more safe is using phytoestrogen. The Citrus reticulata&rsquo;s peel contain flavanone and polimethoxyflavone which are suspected to give estrogenic effect, therefore it is potential to be used as phytoestrogen.The purpose of this study was to examine the estrogenic effect of Citrus reticulata&rsquo;s peel extract in modulation of bone density and blood cholesterol profile of ovariectomized rats (OVX), an animal model of postmenopausal osteoporosis. Thirty six 7-weeks-old female Sprague Dawley rats were assigned to six groups: a SO group, an OVX group, an OVX+CMCNa group, an OVX+extract dose 500 mg/kgBW group, an OVX+extract dose 1000 mg/kgBW group, and an OVX+estradiol group. After 7 weeks, the rats were killed then blood and femoral were collected immediately. The rontgenogram indicated that extract and estradiol administration increase the bone density. And the data analysis with Oneway ANOVA test ,followed by Shceff&eacute; test (P 0.05) showed that extract can improve blood cholesterol profile in dose depend manner. These results suggest a possible role of Citrus reticulata&rsquo;s peel extract as women&rsquo;s health agent because of its beneficial effects on bone and lipids.
oai:jurnal.ugm.ac.id:article/7801
2018-09-22T17:57:58Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7801
2018-09-22T17:57:58Z
Indonesian Journal of Biotechnology
Vol 13, No 2 (2008)
Molecular Genotyping of HBV by using Nested PCR-RFLP among Hepatitis B Patients in Daerah Istimewa Yogyakarta Province and Surrounding Area
Original Research Articles
Haryanto, Aris
Mulyani, Nenny Sri
Widowati, Titis
Wijayanti, Nastiti
Hadi, Purnomo
2008-12-05 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7801
Hepatitis B virus (HBV) can be classified into 8 genotypes, genotype A to H. Genotype of HBV is important for clinical and etiological investigations. Research for HBV genotyping, HBV transmission study using nested PCR and HBV genotyping based on RFLP using restriction enzymes have been reported. However, both of those methods have been not applied for HBV genotyping study among hepatitis B patients in endemic area, like Indonesia yet. Molecular genotyping of HBV will describe epidemiology, pathogenesis and clinical implication of HBV. Combination of nested PCR and RFLP (nested PCR-RFLP) method to determine HBV genotype in Indonesia is still less information. The objectives of study were to develop a system for HBV genotyping by nested PCR combined with RFLP (nested PCR-RFLP) method based on nucleotide sequence of surface protein encoding</div><div>gene (S gene) in HBV genome and to confirm HBV genotypes which predominantly found among hepatitis B patients in Daerah Istimewa Yogyakarta Province and surrounding area. Total of 149 sera from chronic hepatitis B patients from Daerah Istimewa Yogyakarta and surrounding areas were collected for in this work. Viral DNA were extracted from sera of hepatitis B patients and used as template for first round nested PCR amplification using outer primers set. Amplicons of first round PCR were used as template for second round amplification using inner primers set. Then, amplicons of second round nested PCR were restriction digested by Sty I and Bsr I enzymes. For HBV genotyping then the restriction products were analyzed by RFLP based on restriction pattern. Results showed that the first round nested PCR amplification generated DNA fragments of whole S gene in length 1.233 bp, and in second round nested PCR amplification using inner primer set generated DNA fragments 585 bp in length. Genotype analysis for all samples using nested PCR-RFLP methods by restriction digested of Sty I and Bsr I enzymes found only 2 HBV genotypes among hepatitis B patients, namely genotype B and C. Quantification</div><div>data showed that most of hepatitis B patients found infected by HBV genotype B (92,8%), genotype C (3,6%) and unidentified genotype (3,6%). Nested PCR-RFLP methods for HBV genotyping is simple and inexpensive for clinical diagnostic in large scale.
oai:jurnal.ugm.ac.id:article/7802
2018-09-22T17:57:58Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7802
2018-09-22T17:57:58Z
Indonesian Journal of Biotechnology
Vol 13, No 2 (2008)
The Aquaeous Extract of Root Nodules Vigna radiata (rnVr) which Inoculated by Rhizobium as an Orally Available Anemia Therapeutic Candidate
Original Research Articles
Hidayati, Dewi
Nurhidayati, Tutik
Hartanto, Shinta
Nurjannah, N.
2008-12-05 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7802
The extract of root nodules Vigna radiata (rnVr) which inoculated by Rhizobium is considered beneficial as an orally available anemia therapeutic candidate, because it contain the leghemoglobin. The positive control mice (group I) were fed with the high nutrient pellet.The twelve mice (Mus musculus) was treated with the &ldquo;taking rice pellet&rdquo; that representing the low nutrient food for 21 days until they suffered anemia. Then, the anemia mice were treated orally with rnVr in different concentration groups:II. 0% III.33%; IV.67% and V.100%, respectively and fed with the &ldquo;aking rice pellet&rdquo;. After 14 days, the blood mice were collected from orbital sinus. The hemoglobin (Hb) concentration were analyzed by spectrophotometry and blood plasma profile protein were analyzed with electrophoresis (SDS-PAGE). All anemia mice that treated with rnVr showed the increasing of Hb and group that treated with 100% extract of rnVr could reach a normal Hb value, raising from 9.85 to 12.68 g/dL. There were observed the proteins which have molecule weight 36.5 and 35.7 kDa that indicated the existing erythropoietin. The increasing haemoglobin concentration and erythropoietin suggested if extract of rnVr could increasing red blood production and potential as an orally available anemia therapeutic candidate.
oai:jurnal.ugm.ac.id:article/7803
2018-09-22T17:57:58Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7803
2018-09-22T17:57:58Z
Indonesian Journal of Biotechnology
Vol 13, No 2 (2008)
Identification of Pathogenecity of Avian Influenza Virus Subtype H5N1 from Waterfowls Base on Amino Acid Sequence of Cleavage Site Hemagglutinin Protein
Original Research Articles
Susanti, R.
Soejoedono, Retno D.
Mahardika, I Gusti Ngurah K
Wibawan, Wayan T I
Suhartono, Maggy T
2008-12-05 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7803
Identification of pathotype of Avian Influenza Virus (AIV) subtype H5N1 isolates is very important. Thisresearch aimed to identify the pathotype of AIV subtype H5N1 isolated from household waterfowls in West Javabased on molecular markers of amino acid sequences of the Hemagglutinin (HA) cleavage site. Fragments of HAgenes of 21 isolates were amplified using RT-PCR with a primer pair that flanking the cleavage site region, andsequenced with dideoxy-termination method with ABI automatic sequencer (Applied Biosystems). Multiple alignmentof nucleotide and their deduced amino acid sequence were analyzed using ClustalW from MEGA 3.1 program.The result shows that all H5N1 isolates (21 isolates) possess polybasic cleavage sites with 2 patterns ofamino acid sequence, i.e QRERRRKKR (20 isolates) and QRESRRKKR (1 isolate). This finding indicates that all ofthe viruses isolated in this research were of highly pathogenic avian influenza (HPAI) strains.Keywords: cleavage site, waterfowls, HPAI
oai:jurnal.ugm.ac.id:article/7804
2018-09-22T17:59:01Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7804
2018-09-22T17:59:01Z
Indonesian Journal of Biotechnology
Vol 14, No 1 (2009)
Production of Poly-α-hydroxybutyrate (PHB) from Sago Starch by The Native Isolate Bacillus megaterium PSA10
Original Research Articles
Yanti, Nur Arfa
Sembiring, Langkah
Margino, Sebastian
2009-06-02 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7804
A new bacterial strain that produces amylase and poly-a-hidroxybutyrate (PHB) using sago starch as carbon source was characterized and identified to be member of the Bacillus megaterium group based on phenotypic characteristics and 16S rDNA gene sequences. Amylase activity was determined spectrophotometrically on the basis of substrate concentration reduction. PHB production was quantified with UV spectrophotometer. The polymer produced by B. megaterium PSA10 was identified by Fourier Transform Infrared spectroscopy (FTIR). The result of the study showed that the amylase specific activity B. megaterium PSA10 was 593,61 DUN/mg protein and PHB production from sago starch was 52,28 % of cell dry weight (CDW). FTIR analysis of the polymer indicated that the strain B.megaterium PSA10 was a potent PHB producer.
oai:jurnal.ugm.ac.id:article/7805
2018-09-22T17:59:01Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7805
2018-09-22T17:59:01Z
Indonesian Journal of Biotechnology
Vol 14, No 1 (2009)
Cloning and Sequence Analysis of Capsid Protein Gene of Iridovirus Indonesian Isolates
Original Research Articles
Murwantoko, M.
Handayani, Christina Retna
Pratiwi, Rarastoeti
2009-06-02 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7805
Iridovirus was known as agents that caused serious systemic disease in freshwater and marine fishes. The mortality up to 100% of orange-spotted grouper (Epinephelus coioides) due to iridovirus infection has been reported in Indonesia. The gene encoding capsid protein of iridovirus is supposed to be conserved and has the potency for the development of control methods. The objectives of this study are to clone the gene encoding capsid protein iridovirus and to analyze their sequences. The spleen tissues of orange-spotted grouper were collected and extracted their DNA. The DNA fragment of capsid protein of iridovirus genes were amplified by PCR using designed primers with the extraction DNA as templates. The amplified DNA fragments were cloned in pBSKSII and sequenced. The genes encoding capsid protein of iridovirus from Jepara and Bali were successfully amplified and cloned. The Jepara clone (IJP03) contained complete open reading frame (ORF) of the gene composed by 1362 bp nucleotides which encoded 453 amino acids. Those Jepara and Bali (IGD01) clones shared 99.8% similarity in nucleotide level and 99.4% at amino acid level. Based on those sequences, Indonesian iridovirus was belonged to genus Megalocystivirus and shared 99,6-99,9% similarity on nucleotide level with DGIV, ISKNV, MCIV, and ALIV
oai:jurnal.ugm.ac.id:article/7806
2018-09-22T17:59:01Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7806
2018-09-22T17:59:01Z
Indonesian Journal of Biotechnology
Vol 14, No 1 (2009)
Analysis of Toxoplasma gondii Repeat Region 529 bp (NCBI Acc. No. AF146527) as a Probe Candidate for Molecular Diagnosis of Toxoplasmosis
Original Research Articles
Pratama, Dyah Ayu Oktavianie A
Sumartono, S.
Artama, Wayan T.
2009-06-02 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7806
Toxoplasmosis is a disease caused by protozoan parasite Toxoplasma gondii. The infection is commonly asymptomatic. The availability of confirmative and accurate detection system is really needed. This research was aimed to develop a molecular diagnosis based on the conserved and high copy number repeat region of Toxoplasma gondii with hibridization method. Nucleic acid was isolated from tachyzoites. The repeat region of T. gondii was amplified using PuRe Taq Ready To Go-PCR Beads (Amersham Bioscience), forward primer 5’- GAC TCG GGC CCA GCT GCG -3’ and reverse primer 5’- CCT CTC CTA CCC CTC CTC -3’. The amplicon was sequenced using ABI Prism 3100-Avant Genetic Analyzer (PT. Charoen Pokphand, Jakarta). Probe was labeled using digoxigenin-11-dUTP. Application of probe to detect it’s complementary nucloeic acid was done by hibridization method.The research concluded that probe toxo-103 bp was highly homolog with several strain of T. gondii and it has no homology either with host’s genome or other parasites which have close genetic relationship with T. gondii. Hybridization analysis showed that probe could detect the complementary nucleic acid up to 10 ng/ul concentration.
oai:jurnal.ugm.ac.id:article/7807
2018-09-22T17:59:01Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7807
2018-09-22T17:59:01Z
Indonesian Journal of Biotechnology
Vol 14, No 1 (2009)
Isolation and Screening of Antimicrobial Producing-Actinomycetes Symbionts in Nudibranch
Original Research Articles
Riyanti, R.
Widada, Jaka
Rajasa, Ocky Karna
2009-06-02 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7807
The aims of this study were to isolate and to screen actinomycetes associated with sea slug which have the ability to produce antimicrobial compound, especially against MDR strains. Actinomycetes were isolated from nudibranchs collected from Bandengan coastal waters and the Panjang island, Jepara, Central Java. Actinomycete isolates were assayed for their antimicrobial activity against MDR strains (MDR 6 E. coli, MDR 7 Enterobacter sp., MDR 13 Proteus sp., MDR 14 Staphylococcus sp.). The genetic diversity of the active isolates was analyzed by using repetitive DNA fingerprinting. Antimicrobial activity was also performed on the ethyl acetate bacterial extract. The amplification of Polyketide Synthase-I (PKS-I) and Non-Ribosomal Peptide Synthetase (NRPS) genes was carried out to estimate the genetic potency of actinomycetes. The most active actinomycete isolate was sequenced based on 16S rDNA approach. General profile of antimicrobial substances was analyzed by using Thin Layer Chromatography (TLC). A total 27 isolates were obtained from nudibranchs Jorunna sp. and 12 isolates from Chromodoris sp. Ten isolates exhibited antimicrobial activity. Five representative isolates were selected based on rep-PCR analysis. Three ethyl acetate extracts exhibited antimicrobial activity against MDR 7, MDR 13, and MDR 14, except MDR 6. NPC 8 isolates significantly inhibited the growth of the tested strain and amplified NRPS gene fragment. Molecular identification revealed that isolate NPC 8 closely related to Streptomyces sp with a high homology of 96%.
oai:jurnal.ugm.ac.id:article/7808
2018-09-22T17:59:01Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7808
2018-09-22T17:59:01Z
Indonesian Journal of Biotechnology
Vol 14, No 1 (2009)
Effects of Dissolved Oxygen Tension and Ammonium Concentration on Polyhydroxybutyrate Synthesis from Cassava Starch by Bacillus cereus IFO 13690
Original Research Articles
Margono, M.
Rochmadi, R.
Syamsiah, Siti
Cahyanto, Muhammad Nur
2009-06-02 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7808
Attempting to get low price of raw material for producing polyhydroxybutyrate is always studied. Tapioca starch is one of the raw material with low price. The objective of this research was to study the effects of initial ammonium concentration and dissolved oxygen tension (doT) on producing PHB by Bacillus cereus IFO 13690 with tapioca starch as the carbon source. This fermentation was carried out in 5 L fementors with a 2 L working volume, temperature of 30 oC, and agitation of 500 rpm. The pH medium was controlled at 5.6 after it came down from the initial pH of 6.8. Meanwhile, the initial doT was 100 % air saturation and also came down to and maintained at doT of experiment, i.e. 1 , 5 , or 10 % air saturation. The best result was obtained when the initial ammonium concentration was 5 g/L and the doT value maintained at 5 % air saturation. By this conditions, the cell growth reached 5,457 g cell dry weight/L containing PHB of 2.42 % cell dry weigh after 29 hours fermentation.
oai:jurnal.ugm.ac.id:article/7809
2018-09-22T17:59:01Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7809
2018-09-22T17:59:01Z
Indonesian Journal of Biotechnology
Vol 14, No 1 (2009)
Ethanolic Extract of Hedyotis corymbosa L. Increases Cytotoxic Activity of Doxorubicin on MCF-7 Breast Cancer Cell
Original Research Articles
Haryanti, Sari
Junedi, Sendy
Meiyanto, Edy
2009-06-02 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7809
Hedyotis corymbosa L. with ursolic acid as the main compound is one of the plants that has been used for traditional medicine including to cure breast cancer disease. The aim of this research is to examine the cytotoxic activity of rumput mutiara herb ethanolic extract (ERM) and its effect in combination with doxorubicin against MCF-7 breast cancer cell line as cell model of doxorubicin resistance. Hedyotis corymbosa L. herb powder extraction was done by maceration using ethanol 96% then the extract is detected for ursolic acid content. Cell viability assay of ERM, doxorubicin and the combination of ERM and doxorubicin treatments were carried out by MTT assay to determine IC50 and CI (Combination Index). Cell cycle distribution was determined by flowcytometry. Apoptosis assay was performed by ethidum bromide-acridine orange DNA staining method. Investigation on Bcl-2 expression was determined by immunocytochemistry method. Thin Layer Chromatography of ERM had similar Rf with ursolic acid standard: 0,6. ERM and doxorubicin inhibited cell growth against MCF-7 with IC50 of 77 µg/mL and 349 nM (0,19 µg/mL) respectively. Combination of ERM and doxorubicin showed synergistic effect (CI 0.66-0.99). Combination of 25 ìg/mL ERM- 200 nM doxorubicin induced apoptosis and decreased Bcl-2 expression but showed no cell accumulation on cell cycle. Doxorubicin induced high cell accumulation in G2/M phase, but ERM at the concentration of 25 ìg/mL had a low effect in G1 phase, and ERM IC50 did not induce cell accumulation otherwise apoptosis. These results concluded that the apoptosis mechanism of combination doxorubicin-ERM is mediated by cell cycle arrest and non cell cycle arrest. Therefore ERM has a potential activity to be developed as co-chemotherapeutic agent.
oai:jurnal.ugm.ac.id:article/7810
2018-09-22T17:59:41Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7810
2018-09-22T17:59:41Z
Indonesian Journal of Biotechnology
Vol 14, No 2 (2009)
Combination PT-PCR with in vitro Transcription-Translation System: Rapid and Simple Approach for Monoclonal Antibody Production
Original Research Articles
Ali, Muhamad
2009-12-04 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7810
We have developed a simple and efficient system for screening and generation of monoclonal antibodies, which can bypass conventional monoclonal antibody production system that includes time-consuming, labor-intensive establishment and cultivation. Our method consist of: (1) cDNA synthesis from single B cells of immunized mouse, followed by (ii) PCR amplification of the Lc and Hc (Fd portion) cDNAs separately using low concentration (0,05 &igrave;M) of the respective cDNA-specific primers with 5&rsquo; homotags in the presence of the homotag-specific primer (0,5 &igrave;M), (iii) overlapping PCR of the amplified Lc and Hc cDNAs with the cassettes for the T7 promoter (T7P) and T7 terminator (T7T) to construct the following expression units: T7P-Lc-T7T and T7P-Hc-T7T, and (iv) in vitro expression of these units using an Escherichia coli S30 extract followed by ELISA screening without</div><div>purification. Light-and heavy-chain cDNA were amplified and expressed using in vitro system, thus avoiding time consuming steps of cloning and bacterial expression. Having successfully amplified and expressed Lc and Hc genes from single B cells in rapid, simple, versatile, labor-saving, and cost effective, this method seem to be useful</div><div>and applicable for the high-throughput monoclonal antibody generation.
oai:jurnal.ugm.ac.id:article/7811
2018-09-22T17:59:41Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7811
2018-09-22T17:59:41Z
Indonesian Journal of Biotechnology
Vol 14, No 2 (2009)
Decolorization of Remazol Briliant Blue R by Laccase from White Rot Fungus Polyporus sp. S133
Original Research Articles
Hadibarata, Tony
Tachibana, Sanro
2009-12-04 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7811
The decolourization of the recalcitrant dye RBBR by the culture filtrate of Polyporus sp. S133 and its isolatedlaccase was investigated. The laccase alone decolorized RBBR. A small molecular weight redox mediator (HBT) wasnecessary to increase the decolorization. The purified laccase totally decolorized the dye of 200 mg l-1 initialconcentration of RBBR when only 1.5 U ml-1 of laccase was used in the reaction mixture. The effects of differentphysicochemical parameters were tested and optimal decolorization rates occurred at pH 5 and at a temperature of 50°C. The effect of surfactants on the decolourization of RBBR was tested with Tween 80, Tween 20, and Brij 35. It wasdemonstrated that Tween 80 was inhibiting substrate for the decolorization while Tween 80 and Brij 35 was noinhibiting effect for the decolorization. Provided that all of the condition is included, it is suggested that laccase maybe suitable for the wastewater treatment of similar anthraquinone dyes.Keywords: Decolorization; Laccase; Remazol Brilliant Blue R (RBBR); Polyporus sp. S133
oai:jurnal.ugm.ac.id:article/7812
2018-09-22T17:59:41Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7812
2018-09-22T17:59:41Z
Indonesian Journal of Biotechnology
Vol 14, No 2 (2009)
16s rRNA Sequence Analysis and Ammonium Excretion Ability of Nitrogen Fixing Bacteria Isolated from Mineral Acid Soil
Original Research Articles
Hartono, H.
Widada, Jaka
Kabirun, Siti
2009-12-04 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7812
Nitrogen fixing bacteria defined as bacteria which is capable to transform free nitrogen molecules into ammonium v (PCR). Nitrogenase activity of these selected isolates was measured using Acetylene Reduction Assay (ARA). The ability of these selected isolates in ammonium excretion was qualitatively and quantitavely measured using Nessler reagent and spectrophotometry method respectively. Taxonomic position of the selected bacteria were determined based on their 16S rRNA sequence analysis. Genetic diversity analysis of these 15 isolates of nitrogen fixing bacteria yield eight selected bacteria for subsequent analysis. Sequence of nifH gene from all of these selected bacteria were successfully amplified. Nitrogenase assay of these selected bacteria revealed 6 isolates with high nitrogen fixation capasity namely GMA3, GMA5, GMA6, GMA9, GMA12 AND GMA 13.</div><div>Ammonium excretion analysis revealed 4 isolates which have remarkable ability of producing high level of ammonium namely GMA1, GMA3, GMA6, and GMA9. The 16S rRNA sequence analysis shown that isolates GMA3, GMA5, GMA11 and GMA12 had a close relationship with Brevibacillus formosus strain DSM 9885T, Flexibacter canadensis strain ISSDS-428, Rhizobium tropici strain rif 200849, and Azotobacter tropicalis strain RBS. Respectively, isolate GMA1 and GMA13 had a close relationship with Sthenotropphomonas sp. Strain MFC-C, while isolate GMA6 and GMA9 had a close relationship to Azotobacter vinelandii strain ISSDS-428.</div>', 'string'),(105, 'en_US', 'subject', 'nitrogen fixing bacteria, ammonium excretion, identification', 'string'),(105, 'en_US', 'sponsor', '', 'string'),(107, 'en_US', 'title', 'Effect of Probiotic Lactobacillus sp. Dad13 on Humoral Immune Response of Balb/C Mice Infected with Salmonella typhimurium', 'string'),(107, 'en_US', 'abstract', 'An indigenous strain of lactic acid bacterium (LAB) identified as Lactobacillus spp. Dad13 (Dad13), isolated from traditional fermented buffalo milk, was found to be potential as probiotic. The aim of this research was to study the effect of probiotic Dad13 on humoral immune response of Balb/C mice infected with Salmonella typhimurium. Thespecific objective was to find out the effect of different Dad13 consumption time (before and along with infection of S. typhimurium) on the humoral immune response of Balb/C mice. The experiment was conducted by in vivo trial on 20<br />males of Balb/C mice, age of 6-8 weeks, fed with AIN-93 standard diet. The mice were assigned into 4 groups. Each group received the following treatments, ie. Dad13 only, Dad13 before infection, Dad13 along with infection and Salmonella infection only. A volume of 100 &mu;l Dad13 cell suspensions (1010 CFU/ml) were given by oral forced feeding daily for a week, at week 3 for group before infection and at week 4 for group of Dad13 only and Dad13 along with infection. Salmonella infection (109 CFU/ml) was given once orally at week 4 to all groups except group treated with Dad13 only. The humoral immune response of Balb/C mice was detected 2 weeks after infection by measuring the titers of IgG and IgA specific from serum and mucosal intestinal liquid samples using Enzyme-linked Immunosorbent Assay (ELISA) method. The result indicated that humoral immune response of Balb/C mice consuming Dad13 before and along with Salmonella infection were significantly different (p&lt;0.05). Dad13 consumption along with Salmonella infection increased circulated IgG and IgA as well as secretory IgA. It can be concluded that Dad13 probiotic feeding along with infection increased humoral immune response more significantly compared to that before infection.
oai:jurnal.ugm.ac.id:article/7813
2018-09-22T17:59:41Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7813
2018-09-22T17:59:41Z
Indonesian Journal of Biotechnology
Vol 14, No 2 (2009)
Diversity of Actinomycetes at Several Forest Types in Wanagama I Yogyakarta and Their Potency as a Producer of Antifungal Compound
Original Research Articles
Nurjasmi, Reni
Widada, Jaka
Ngadiman, N.
2009-12-04 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7813
Actinomycetes are bacterial groups that produce many secondary metabolites, which different biological activities, such as antifungi, antibacteria, antivirus, antitumor, etc. Actinomycetes are widely distributed in soil and their diversity is influenced by type of forest. The aim of this study is to investigate diversity of actinomycetes in several forest types of Wanagama I forest in Yogyakarta and their potency as a producer of antifungal compound. Soil samples under the forest of Tectona grandis, Swietenia macrophylla King, Bamboosa vulgaris, Melaleuca leucadendron, and Gliricidia maculata were used as sources of soil bacteria. Bacteria and actinomycetes communities were analyzed through culture-independent approach by RISA and nested-PCR RISA using actinomycetes spesific primer (F243), respectively. Through culture-dependent approach, isolated actinomycetes diversity were analyzed by identification of morphology (colony and cell), genetic (BOX element by rep-PCR), and secondary metabolites (thin layer chromatography). In addition, isolates were assayed for their antifungal activity against Saccharomyces cerevisae, Candida albicans, Fusarium oxysporum and Aspergillus flavus. The presence of Polyketide Synthase-I (PKS-I) and NonRibosomal Peptide Synthetase (NRPS) genes were amplified by PCR to study their correlation with antifungal activity of the actinomycete isolates. The results showed that types of forest influence diversity of rhizobacteria especially actinomycetes. According to culture-independent approach, relatively, com-</div><div>munity of rhizobacteria from the highest were soil under the forest of B. vulgaris, G. maculata, T. grandis, S.macrophylla King, and M. leucadendron, respectively. Meanwhile, community of actinomycetes from the highest were soil under the forest of G. maculata, B. vulgaris, M. leucadendron, S. macrophylla King, and T. grandis, respec- tively. Fourty-three morphologically different isolates were found by using culture-dependent approach consisting of 17 isolates were found in soil under the forest of M. leucadedron, each of 9 isolates in G. maculata and T. grandis, 6 isolates in S. macrophylla King. and 2 isolates in B. vulgaris. More diversity of secondary metabolites were observed in soil actinomycetes under the forest of M. leucadendron. Of the 43 isolates, 100% were active against S.cerevisae, 37.20% against C. albicans, 95.30% against F. oxysporum, and 83.70% against A. flavus. Antifungal activity of actinomycete isolates did not always have correlation with the presence of PKS-I and NRPS.
oai:jurnal.ugm.ac.id:article/7814
2018-09-22T17:59:41Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7814
2018-09-22T17:59:41Z
Indonesian Journal of Biotechnology
Vol 14, No 2 (2009)
Isolation and Analysis of DNA Fragment of Genes Related to Kopyor Trait in Coconut Plant
Original Research Articles
Sukendah, S.
Volkaert, Hugo
Sudarsono, S.
2009-12-04 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7814
Kopyor coconut is a natural mutant that has abnormal endosperm development. For the first time several genes that were suspected to be related to kopyor trait were identified based on the chemical compounds of the endosperm that different from that of normal coconut. Sucrose synthase (SUS), Stearoyl acyl carrier protein desaturase (SACPD), and Absicid acid insensitive (ABI) genes were isolated and analyzed. Four DNA fragments with length of 746, 738, 780, and 687 bp (CnSus1A, CnSus1B, CnSus2A, and CnSus2B) were obtained from SUS gene. Sequence analysis at DNA and amino acid level showed that CnSus1A, CnSus1B, CnSus2A, and CnSus2B were classified into monocot SUS group with nongrass SUS type. Isolation of SACPD gene resulted in one DNA fragment with DNA length of 716 bp. CnSacpd shared a high homology with SACPD gene of oil palm and soybean. Isolation of ABI gene resulted in two DNA fragments, CnAbi3A and CnAbi3B, with DNA length of 760 and 728 bp, respectively. CnAbi3A and CnAbi3B showed a high homology with ABI3 gene of several plants. All DNA fragment obtained from SUS, SACPD, ABI genes were used as templates to design spesific markers for each corresponding gene. There were 7 specific primer sets designed, i.e., CnSUS1A, CnSUS1B, CnSUS2A, CnSUS2B, CnSACPD, CnABI3A, and CnABI3B.<
oai:jurnal.ugm.ac.id:article/7815
2018-09-22T17:59:41Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7815
2018-09-22T17:59:41Z
Indonesian Journal of Biotechnology
Vol 14, No 2 (2009)
Construction and Immunogenicity Testing of Salmonella, STM1 Vaccine Vector Expressing HIV-1 Antigen
Original Research Articles
Bachtiar, Endang Winiati
Smooker, Peter
Coloe, Peter J
2009-12-04 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7815
Objective of this study: to determine the ability of Salmonella enterica serovar Typhimurium STM1 as a delivery vehicle for the HIV p24 gene and HIV env gene. The STM1 delivery HIV-p24 vaccination was carried out in the form of a recombinant or a DNA vaccine whereas only a DNA vaccine was used for HIV env. Naked DNA vaccination was also tested and immune responses were evaluated following immunisation in mouse model. Results: vaccination cellular immune responses induced by recombinant p24 STM1 (STM1/pHly-p24) were greater than those elicited by the p24 DNA vaccine in STM1 (STM1/VR-p24), (but statistically not significance) than those induced by oral vaccination. However, IgA responses induced by oral vaccination with either a recombinant or DNA vaccine of p24 in STM1 are higher than those induced by IP vaccination. Conclusions: This result confirms</div><div>other studies that Salmonella was able to deliver HIV antigens to the immune system and induced specific immune responses to the HIV antigen.
oai:jurnal.ugm.ac.id:article/7816
2018-09-22T18:00:30Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7816
2018-09-22T18:00:30Z
Indonesian Journal of Biotechnology
Vol 15, No 1 (2010)
Molecular cloning of gene fragment encoding 4-coumarate: Coenzyme A ligase of Sengon (Paraserianthes falcataria)
Original Research Articles
Hartati, Sri N.
Sudarmonowati, Enny
Suharsono, S.
Sofyan, Kurnia
2010-06-02 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7816
4-coumarate:Coenzyme A ligase (4CL) plays an important role in lignin biosynthetic pathway thatcatalyzed the activation of coumaric acid, caffeic acid or ferulic acid to be a syringil monomer. Ligninbiosynthesis control through 4CL down regulating would support lower lignin wood production. Theobjective of this study was to clone conserved region cDNA of gene encoding 4CL. Gene fragment isolation wasconducted by means of reverse transcriptase polymerase chain reaction (RT-PCR) using degenerateheterologous primer. The RT-PCR products were purified, sequenced and analyzed to select the highlyhomologous fragment to 4CL. BLASTanalysis result showed that deduction of amino acid sequences from oneof two RT-PCR product nucleotide was highly homologous with the 4CL conserved region from Rubbus ideaus,Oryza sativa, Populus tomentosa, Populus balsamifera, Betulla platyphilla, Nicotiana tabacum, and Arabidopsisthaliana with identity ranging from 78-90%.Key words: 4-coumarate: Coenzyme A ligase, lignin, sengon
oai:jurnal.ugm.ac.id:article/7817
2018-09-22T18:00:30Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7817
2018-09-22T18:00:30Z
Indonesian Journal of Biotechnology
Vol 15, No 1 (2010)
An Actinomycetes Producing Anticandida Isolated from Cajuput Rhizosphere: Partial Identification of Isolates and Amplification of pks-I genes
Original Research Articles
Alimuddin, A.
Asmara, Widya
Widada, Jaka
Mustofa, M.
Nurjasmi, Reni
2010-06-02 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7817
Actinomycetes have been the most prolific producer of various kinds of antifungal metabolites, and many of them are described as being produced by polyketide synthetases (pks). We present strain of Actinomycetes producing anticandida isolated from rhizosphere plant for amplification of Pks-I genes. The isolate was obtained from Wanagama I Forest UGM Yogyakarta. Gene of seven isolates, from total of 173 isolates, were amplified using degenerate primer to detect the presence of pks genes. One strain that is named Streptomyces sp. GMR-22 was partialy identified as anticandida producing actinomycete. The strain shown the strongest activity against Candida albicans. Based on bioautography assay, one spot active with Rf 0.57 was appeared as bright yellow by cerrium sulphate but it was and not visible on UV254 and 366 lights. Key words : pks genes, anticandida, Streptomyces sp GMR-22, rep-PCR, cajuput rhizosphere
oai:jurnal.ugm.ac.id:article/7818
2018-09-22T18:00:30Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7818
2018-09-22T18:00:30Z
Indonesian Journal of Biotechnology
Vol 15, No 1 (2010)
Detection and Cloning of a Gene Involved in Zwitermicin A Synthesis from Plant Growth Promoting Rhizobacteria of Bacillus sp CR64
Original Research Articles
Wahyudi, Aris Tri
Astuti, Rika Indri
Mubarik, Nisa Rachmania
Faulina, Sarah Asih
2010-06-02 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7818
Utilization of soil bacteria as biocontrol agent is becoming popular due to its valuable and effective mechanisms to suppress plant pathogenic microbes. We have previously isolated Bacillus sp, designated as Bacillus sp CR64, which exhibited effective plant growth promoting and antifungal activities. In this study, CR64 was examined in inhibiting the growth of Rhizoctonia solani, the causing agent of root rot disease. Partial sequence analysis of 16S rRNA gene revealed that this isolate similar with Bacillus cereus (94%). Furthermore, a gene designated zmaR was detected by means of specific amplification of DNA fragment approximately 950 bp. This fragment was then cloned onto pCRII-TOPO (3.9 kb) and sequenced using DNA sequencer ABI PRISM 310. Sequence analysis revealed that it had highest homology with the ZmaR protein (89% identity; 90% similarity) of B. thuringiensis serovar kurstaki (AAF82729.2). Alignment analysis with other ZmaR sequences from other antibiotic-producing Bacilli exhibited an almost fully conserved region within ZmaR sequences.Key words : PGPR, Bacillus sp CR64, Zwitermicin A, Cloning, Antifungal.
oai:jurnal.ugm.ac.id:article/7819
2018-09-22T18:00:30Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7819
2018-09-22T18:00:30Z
Indonesian Journal of Biotechnology
Vol 15, No 1 (2010)
Characterization of envelope-transmembrane Gene of Jembrana Disease Virus Tabanan 1995 Isolate
Original Research Articles
Kusumawati, Asmarani
Pratiwi, Rarastoeti
Astuti, Pudji
Hamid, Penny Humaidah
2010-06-02 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7819
The availability of specific and rapid detection methods is essential for monitoring the health status of farmed species, particularly in viral disease as in this case early diagnosis is a critical factor in containing disease outbreaks. Jembrana Disease Virus (JDV) is a lentivirus that causes an acute, severe disease syndrome in infected Bali cattle in Indonesia, resulting in heavy economic losses because of the high mortalities. The virus-host interaction and the modes of transmission are still unknown. The goal of the research was to designa probe candidate of Jembrana Disease Virus based on envelope-transmembrane (env-tm) gene to optimize Jembrana disease detection method. The DNA fragment derived from env-tm of JDV was used, cloned in pGEX-TM and expressed in E.coli DH 5α. Sequence analysis was conducted with BLAST programs from NCBI. Sequence analyses of the fragments of env-tm clone, indicated that it has a very closed genetic relation with 97,68% homology identity. Probe was designed based on the conserved region of env-tm using Geneious resulted in JT2 252 bp long. BLAST analyses showed that probes had high specifity to other strains of JDV in Indonesia.Key words : probe, env-tm, JDV, specifity, sensitivity.
oai:jurnal.ugm.ac.id:article/7820
2018-09-22T18:00:30Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7820
2018-09-22T18:00:30Z
Indonesian Journal of Biotechnology
Vol 15, No 1 (2010)
Purification and Characterization of Streptomyces sp. IK Chitinase
Original Research Articles
Margino, Sebastian
Nugroho, Agustinus Joko
Asmara, Widya
2010-06-02 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7820
Streptomyces sp. IK isolated from compost inoculants, could produce extra cellular chitinase in a medium containing 0.2% (w/v) colloidal chitin, fermented for 96 hours at 30oC. The enzyme was purified by a combination of ammonium sulphate precipitation and DEAE-Cellulose anion-exchange chromatography. On SDS-polyacrylamide gel electrophoresis analysis, the purified enzyme showed a mass of 71 kDa. Chitinase was optimally active at pH of 6.7 and at 37oC. Km value and Vmax of the protein for colloidal chitin were 2.92 mg/ml and 4.26 ìg/h, respectively.Key words : chitinase, Streptomyces, purification, characterization
oai:jurnal.ugm.ac.id:article/7821
2018-09-22T18:00:30Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7821
2018-09-22T18:00:30Z
Indonesian Journal of Biotechnology
Vol 15, No 1 (2010)
Comparative Analysis of Rice Transformation Using Agrobacterium tumefaciens and Rhyzobium leguminosarum
Original Research Articles
Rahmawati, Syamsidah
Jefferson, Osmat Azzam
Sopandie, Didy
Suharsono, S.
Slamet-Loedin, Inez Hortense
2010-06-02 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7821
This study was aimed to study the effectiveness of Rhizobium transformation system compared to the most widely used Agrobacterium mediated transformation system on three rice cultivars, Ciherang (Indica), Nipponbare (Japonica), and Rojolele (Javanica). Six day old calli induced from immature embryos were inoculated with Rhizobium leguminosarum bv trifolii ANU845 and Agrobacterium tumefaciens LBA288 that harbored with vector pCAMBIA 5106. This plasmid contained a minimum set of transfer machinery genes and had a gusplus and an hptII gene driven by 35S CaMV promoter in the T-DNA. The results showed that the transformation frequencies (number of PCR positive plants per number of calli inoculated) ranging from 0 to 12.05 % depend on the genotype and transfer agent used. The highest transformation frequency (12.05%) was obtained in Ciherang transformed with R. leguminosarum. Most of the transgenic rice obtainedby Rhizobium transformation were normal in morphology and fertile similar to those obtained by Agrobacterium transformation. Integration, expression and inheritance of transgenes were demonstrated by molecular and genetic analysis in T0 and T1 generations.Key words : Rhizobium leguminosarum, immature embryos, Agrobacterium tumefaciens
oai:jurnal.ugm.ac.id:article/7822
2018-09-22T18:01:28Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7822
2018-09-22T18:01:28Z
Indonesian Journal of Biotechnology
Vol 15, No 2 (2010)
Comparison of Cytotoxic and Antiproliferative Effects of Benzylidenecyclopentanone Analogues of Curcumin on RBL-2H3 Cells
Original Research Articles
Nugroho, Agung Endro
Sardjiman, S.
Maeyama, Kazutaka
2010-12-06 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7822
Curcumin is a natural yellow pigment isolated from the rhizomes of Curcuma longa L. (turmeric), and has several pharmacological effects and no toxicity in both in animal and human clinical study. However, the problem of curcumin is its stability because of its active methylene moiety. Modification of this moiety to cyclopentanone is expected to increase the stability. Previous study reported that benzylidenecyclopentanone analogues of curcumin showed inhibitory effect on histamine release from RBL-2H3 (rat basophilic leukemia) cells, a tumor analog of mast cells. One of them, the hydroxy-methoxy analog (PGV-0), showed more potent effect than that of curcumin. In the present study, some benzylidenecyclopentanone analogues of curcumin were evaluated for their effects on the viability and proliferation of RBL-2H3 cells. Viable cells were counted under a light microscope with a cells-counting chamber or using the cell viability reagent WST-1. The results showed that mast cell viability and histamine content were not affected by curcumin and benzylidene cyclopentanone for 30 min incubation, however, impaired for overnight incubation. The hydroxy-dimethyl benzylidene analog (PGV-1) strongly decreased the mast cells viability for overnight incubation, and its effect was highest among the other analogues. In the proliferation study, this compound also strongly inhibited the proliferation of mast cells, whereas curcumin and hydroxy-methoxy benzylidene analog inhibited the proliferation slightly. There were no inhibitory effects on mast cells proliferation treated by dibenzylidene; dihydroxybenzylidene; and hydroxy-diethylbenzylidene cyclopentanone.Keywords : viability, proliferation, curcumin, benzylidene cyclopentanone, RBL-2H3 cells
oai:jurnal.ugm.ac.id:article/7823
2018-09-22T18:01:28Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7823
2018-09-22T18:01:28Z
Indonesian Journal of Biotechnology
Vol 15, No 2 (2010)
Effect of Nuclear Export Inhibitor Leptomycin B on the Intracellular Localization of HBV Core Protein into Hepatocytes Cell Line Huh-7 and HepG2 Cells
Original Research Articles
Haryanto, Aris
Wijayanti, Nastiti
Kann, Michael
2010-12-06 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7823
Leptomycin B (LMB) was originally discovered as a potent anti-fungal antibiotic from Streptomyces species. The cellular target of LMB has been identified as the nuclear export receptor CRM-1 or exportin-1, which is involved in nuclear trafficking of cellular RNAs or proteins containing the nuclear export sequence (NES). CRM-1 is the main mediator of nuclear export in many cell types including hepatocyte cell lines. The ability of LMB to inhibit nuclear export has made it a useful tool in the study of the intracellular localization of manyregulatory proteins. In this study, we evaluated the effect of nuclear export inhibitor LMB treatment on the intracellular localization of HBV core protein into the hepatocyte cell lines, Huh-7 and HepG2 cells. We also reported the quantification of the distribution of EGFP-Core fusion protein with redundant core NLS as well as SV-40 NLS into cell compartments. Results shown that in Huh-7 cells treatment of LMB caused retention of EGFP-Core fusion protein into the nucleus, so increased the nuclear localization of EGFP-Core and all variants.In HepG2 cells, although not significantly, treatment of LMB increased a number of nuclear localization in all EGFP-Core constructions, even the nuclear localization in HepG2 cells is not so high as in Huh-7 cells. Keywords: Leptomycin B, HBV, core protein, intracellular localization, NLS, Huh-7, HepG2 cell
oai:jurnal.ugm.ac.id:article/7824
2018-09-22T18:01:28Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7824
2018-09-22T18:01:28Z
Indonesian Journal of Biotechnology
Vol 15, No 2 (2010)
Ethanol Production by Fermentation of Various Sweet-Stalk Sorghum Juices Using Various Yeast Strains
Original Research Articles
Widianto, Donny
Arofatullah, Akbar
Yuwono, Triwibowo
Prijambada, Irfan Dwidya
2010-12-06 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7824
The ethanol production by fermentation of sweet-stalk sorghum juice is affected by the juice composition and the capability of the yeast strain to ferment it. Eight yeast strains were tested on their growth and ethanol fermentation abilities in sweet-stalk sorghum juices extracted from three cultivars of sweet sorghum. The best specific growth rate of the yeast strains grown aerobically in the yeast extract peptone dextrose (YEPD) broth and the sweet-stalk sorghum juices of KCS105, FS501, and FS902 cultivars, were achieved by OUT7903, OUT7913, OUT7903, and OUT7027 yeast strains, respectively. However, the best specific CO2 evolution rate of the yeast strain during fermentation of the juices was achieved by OUT7027 yeast strains. The highest ethanol concentration, ethanol yield, and sugar conversion efficiency (SCE) were obtained by strain OUT7921 when it was employed to ferment sweet-stem sorghum juice of FS902 cultivar. It was also observed that the juice extracted from sweet-stalk sorghum of FS902 cultivar is the most suitable medium for all yeast strains to achieve their best fermentation abilities. Thus, it is likely that the growth and ethanol production ability of a yeast strain in sweet-stalk sorghum juice depend on the physiological responses of the yeasts to nutrientcomposition of the sorghum juice and the sorghum cultivar from which the juice was extracted.Key words : Sweet-stalk sorghum juice, ethanol, fermentation, yeast
oai:jurnal.ugm.ac.id:article/7825
2018-09-22T18:01:28Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7825
2018-09-22T18:01:28Z
Indonesian Journal of Biotechnology
Vol 15, No 2 (2010)
Cloning of Thermostable DNA Polymerase Gene from a Thermophilic Brevibacillus sp. Isolated from Sikidang Crater, Dieng Plateu, Central Java
Original Research Articles
Witasari, Lucia Dhiantika
Prijambada, Irfan Dwidya
Widada, Jaka
Arif Wibawa, Dionysius Andang
2010-12-06 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7825
Thermostable DNA polymerase has an important role for amplifying small amount of DNA through polymerase chain reaction (PCR). Thermophillic bacteria Brevibacillus sp. was isolated from Sikidang Crater, Dieng Plateu, Central Java. Previous study showed that crude protein of the isolate could be used in PCR. Unfortunately, like most native thermostable enzymes, the thermostable DNA polymerase of the isolate is synthesized in a very low level and therefore is cumbersome to purify. The purpose of this research is to clone thermostable DNA polymerase gene of the isolate. The DNA polymerase gene was amplified by means of PCR using spesific primers. The amplified fragment was then isolated, purified, and ligated into the pGEM-T cloning vector. The recombinant plasmid was then transformed to competent E. coli JM109 cells using heat shock method. The cloned thermostable DNA polymerase gene from the thermophilic isolate was then characterized for its nucleotide base sequence. The result showed that the DNA Pol I gene was successfully be amplified from the isolate DNA genom, resulting in ± 2,7 kb DNA fragment in length. Sequence analysis of segment of targeted gene showed high similarity to that of thermostable DNA polymerase genes from other Bacillus.Key words : Thermostable DNA Pol I, Brevibacillus sp., PCR, cloning
oai:jurnal.ugm.ac.id:article/7826
2018-09-22T18:01:28Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7826
2018-09-22T18:01:28Z
Indonesian Journal of Biotechnology
Vol 15, No 2 (2010)
Identification of Metabolic Intermediates in Microbial Degradation of Chrysene by Armillaria sp. F022
Original Research Articles
Hadibarata, Tony
Kristanti, Risky Ayu
2010-12-06 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7826
To degrade chrysene, a polycyclic aromatic hydrocarbon (PAH), Armillaria sp. F022, a fungus collected from a soil, was used. Maximal degradation (77%) was obtained when Armillaria sp. F022 was incubated in cultures agitated at 120 rpm for 30 days, as compared to just 41% degradation in stationary culture. Furthermore, the degradation of chrysene was affected by the addition of surfactants. The mechanism of degradation was determined through identification of the intermediates. Several enzymes (manganese peroxidase, lignin peroxidase, laccase, 1,2-dioxygenase and 2,3-dioxygenase) produced by Armillaria sp. F022 were detected in the culture. The highest level of activity was shown by 1,2-dioxygenase after 20 days (143.6 U l-1). Theseligninolytic and dioxygenase enzymes played an important role in the oxidation of chrysene. Chrysene was indeed degraded by Armillaria sp. F022 through several intermediates, chrysenequinone, 2-((1E,3E)-4-carboxy-3-hydroxybuta-1,3-dien-1-yl)-1-naphthoic acid , 1-hydroxy-2-naphthoic acid, and gentisic acid.Keywords : Biodegradation, Chrysene, Metabolites, Armillaria sp. F022
oai:jurnal.ugm.ac.id:article/7827
2018-09-22T18:01:28Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7827
2018-09-22T18:01:28Z
Indonesian Journal of Biotechnology
Vol 15, No 2 (2010)
The Distribution of MAP-2 Phosphorylation in Cerebral Cortex of Long-Tailed Monkey Fetuses (Macaca fascicularis) in the Last Trimester of Gestation
Original Research Articles
Pangestiningsih, Tri Wahyu
Irawan, Vidya
Sulistiawati, Erni
2010-12-06 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7827
Memories are storage in cholinoceptive cells, the cells which are enriched with microtubule-associated protein 2 (MAP-2) that localized in the neuronal dendrite and the cell bodies. Phosphorylation of MAP-2 may increase memory with reduce stability of dendrite by altered dendrite length and lead new side-branches of neuronal as a neuronal plasticity processes in cerebral cortex. The aim of this research is to study the distribution of MAP-2 phosphorylation neurons in cerebral cortex of long-tailed macaques in the third semester of gestationalimmunohistochemically using avidin biotin conjugated complex method. Neurons MAP-2 phosphorylation immunoreactive were located in dendrites and cell bodies, mostly in pyramidal neurons of cerebral cortex. Intensity of MAP-2 phosphorylation immunoreactivity in layer V were stronger than another layer and the neurons that very intensely stained were the pyramidal cells in frontal and parietal lobes, that was suggested that neurons in this areas more responsive to neuroplasticity. From the results we concluded that MAP-2 phosphorylation already distributed in the cerebral cortex of long-tailed macaque fetuses at the last trimester of gestation, mostly in the pyramidal cells of layer V that is suggested plays a role for preparation of memoryformation.Keywords: fetus, long-tailed monkey, cerebral cortex, memory, MAP-2 phosphorylation
oai:jurnal.ugm.ac.id:article/7828
2018-09-22T18:02:02Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7828
2018-09-22T18:02:02Z
Indonesian Journal of Biotechnology
Vol 16, No 1 (2011)
The Detection of Mutational Changes in Sorghum using RAPD
Original Research Articles
Taryono, T.
Cahyaningrum, Paramita
2011-06-08 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7828
Sorghum is a multifunction plant due to its high economic value as a source of food, feed and industrial raw material of biofuel. Sorghum improvement can be done through mutation breeding and this research was conducted to evaluate the power of mutation breeding by observing the difference between mutant and its original counterpart. Varieties of sorghum Durra, Zhengzu and their mutants B-100 and Zh-30 were arranged in completely randomized design. DNA extraction was done using a modified CTAB method. After purification, quantification, and dilution, PCR was carried out for RAPD analysis. The result showed that Durra and Zhengzu varieties were significantly different in plant height, number of leaves and seed colour, however the mutant and its original counterpart cannot be differentiated morphologically. RAPD can be used to differentiate mutant and its original counterpart by observing the specific band pattern from each primer.
oai:jurnal.ugm.ac.id:article/7829
2018-09-22T18:02:02Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7829
2018-09-22T18:02:02Z
Indonesian Journal of Biotechnology
Vol 16, No 1 (2011)
Antifungal Production of a Strain of Actinomycetes spp Isolated from the Rhizosphere of Cajuput Plant: Selection and Detection of Exhibiting Activity Against Tested Fungi
Original Research Articles
Alimuddin, A.
Widada, Jaka
Asmara, Widya
Mustofa, M.
2011-06-08 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7829
Actinomycetes are bacteria known to constitute a large part of the rhizosphere microbiota. Their isolation is an important step for screening of new bioactive compounds. Culturable actinomycetes populations from cajuput plant rhizosphere soils in Wanagama I Forest UGM Yogyakarta were collected to study about their antifungal activity. Among 17 of a total 43 isolates that showed activity were screened for producing antifungi substances. Screening for antifungal activity of isolates were performed with dual culture bioassay in vitro. One isolate that was designated as Streptomyces sp.GMR-22 was the strongest against all tested fungi and appeared promising for a sources of antifungal. Culture’s supernatant and mycelia were extracted with chloroform, ethyl acetate and methanol, respectively. Antifungal activity of crude extracts was tested by diffusion method against tested fungi. The result indicates that isolates of actinomycetes from cajuput plant rhizosphere could be an interesting sources of antifungal bioactive substances.
oai:jurnal.ugm.ac.id:article/7830
2018-09-22T18:02:02Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7830
2018-09-22T18:02:02Z
Indonesian Journal of Biotechnology
Vol 16, No 1 (2011)
DIGoxigenin (DIG) Labeled Probe Candidate of Surface Antigen 1 (SAG1) for Toxoplasma gondii Detection
Original Research Articles
Kusumawati, Asmarani
Septiana, Nafratilova
Hartati, Sri
2011-06-08 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7830
Toxoplasma gondii is one of the opportunistic pathogen that causes toxoplasmosis. Infection of Toxoplasma gondii has been estimated as high both in human and animal. The manifestation of infection were abortion, hydrocephalus, brain calcification, chorioretinal scar, and loss of productivity even to death in patients with acquired immunosuppression. Early diagnostic method which are rapid and accurate is essential for T. gondii detection because of its high prevalence. The purpose of this study was to develop a sensitive probes derived from Surface Antigen 1 (SAG1) for detection T. gondii and to examine the specificity and sensitivity of probe as diagnostic tool for toxoplasmosis. This research used SAG1 gene of T. gondii local isolate IS-1 that was cloned into pGEX-2T and transformed into Eschericia coli DH5α. The sequence of SAG1 was labeled with DIGoxigenin (non radioactive labeled) using PCR DIG Labeling Mix to derive 213 bp (probe-TS). BLAST and dot-blot hybridization analyses showed that probes had high specifity with other strains of T. gondii. Probe was able to detect T. gondii DNAup to 10 ng/μl of total sample DNA.
oai:jurnal.ugm.ac.id:article/7831
2018-09-22T18:02:02Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7831
2018-09-22T18:02:02Z
Indonesian Journal of Biotechnology
Vol 16, No 1 (2011)
Microorganisms Associated with Volatile Organic Compound Production in Spoilt Mango Fruits
Original Research Articles
Ibrahim, Aliyu D.
Oyeleke, Bankole S.
Muhammad, Ummul Khaltum
Aliero, Adamu Aliyu
Yakubu, Sabo E.
Safiyanu, Hadiza M.
2011-06-08 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7831
Microorganisms associated with the production of volatile compound in spoilt mango fruits sold in Sokoto town were isolated and identified. The organisms include seven species of bacteria and a species of yeast. These include Bacillus pumilus, Bacillus firmus, Brevibacillus laterosporus, Morganella morganii, Paenibacillus alvei, Staphylococcus saccharolyticus, Listeria monocytogenes and Candida krusei respectively. GC-MS analysis revealed the presence of eleven and sixteen volatile organic compound in the healthy and spoilt ripe mango fruits. Octadecanoic acid, oleic acid, 1 – Butanol, 3 – methyl-, carbonate (2:1) and 3,7 – Dimethyl nonane were common to both healthy and spoilt fruits with the first three having higher concentration in healthy fruits than spoilt while the later had higher concentration in the spoilt. One methyl group of 3,3- Dimethyl hexane in healthy fruit was shifted to position two to yield 2,3-Dimethyl hexane in the spoilt fruits. 2,2-Dimethylbutane, Methyl(methyl-4-deoxy-2,3-di-O-methyl.beta.1-threo-hex-4-enopyranosid) urinate, 3-(4-amino-phenyl)-2-(toluene-4-sulfonylamino)-propionic acid, 2-Methyl-3-heptanone, 3,5-Nonadien-7-yn-2-ol, (E,E), Butanoic acid, 1,1-dimethylethyl ester, 1-methyl-3-beta.phenylethyl-2,4,5-trioxoimidazolidine, Pentanoic acid, 2,2-dimethyl, ethyl ester (Vinyl 2,2-dimethylpentanoate), 4-Methyurazole, 1-Tridecyn- 4 – 9 – ol, 1-Hexyl-1-nitrocyclohexane were unique to spoilt fruits. This study suggests that these unique volatile metabolites could be exploited as biomarkers to discriminate pathogens even when more than one disease is present thereby curbing post harvest loss during storage after further validation and the volatile organic compound could form the basis for constructing a metabolomics database for Nigeria.
oai:jurnal.ugm.ac.id:article/7832
2018-09-22T18:02:02Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7832
2018-09-22T18:02:02Z
Indonesian Journal of Biotechnology
Vol 16, No 1 (2011)
Effect of Substrate Concentration to Anode Chamber Performance in Microbial Electrolysis Cell
Original Research Articles
Darus, Libertus
2011-06-08 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7832
Microbial electrolysis is a promising process for bio-hydrogen production which might be implemented in waste water treatment in a near future. Unfortunately substrate could be converted into methane by acetoclastic methanogens and will reduce the coulombic efficiency (CE). The research objective was to study the competition between electrogens and methanogens for substrate in a continuous Microbial Electrolysis Cell (MEC).The competition was studied in relation to controlling acetate influent concentration (Cin) from 35 to 1 mM with a fixed anode potential -350 mV, by assessing activity of electrogens as current density (CD), activity of acetoclastic methanogens as methanogenic consumed acetate (Cmeth), and CE and by measuring anolyte protein content to confirm a steady state condition. Controlling Cin from 35 to 1 mM resulted in tendency of both CD and Cmeth to decrease and CE to increase. At decreasing Cin from 35 to 5 mM which left excess acetate concentration in anolyte, the CEs were between 36.4% and 75.3%. At further decreasing Cin to 1 mM the acetate concentration was limited (Cef 0 mM), but the CE only reached 95.8%. Methanogenesis always occur and electrogens were not able to outcompete the acetoclastic methanogens even though the substrate concentration was limited.Keywords : microbial electrolysis cell, bio-hydrogen, metanogenesis, substrate concentration
oai:jurnal.ugm.ac.id:article/7833
2018-09-22T18:02:02Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7833
2018-09-22T18:02:02Z
Indonesian Journal of Biotechnology
Vol 16, No 1 (2011)
Application of Multiplex RT-PCR for Detection of Cucurbit-infecting Tobamovirus
Original Research Articles
Daryono, Budi Setiadi
Natsuaki, Keiko T.
2011-06-08 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7833
Cucumber green mottle mosaic virus (CGMMV) and Kyuri green mottle mosaic virus (KGMMV) are seed borne viruses and they are also transmitted mechanically during agricultural practice and through water. Hence, these viruses have potential diseases widely distributed throughout the world. To detect different strains of CGMMV and KGMMV, several specific primers for each virus were designed for single and multiplex RT-PCR. The results of single and multiplex RT-PCR showed that CGMMV was detected in zucchini isolated in Bali-Indonesia, while KGMMV was detected both in zucchini isolated in Bali-Indonesia and Cucumis metuliferus isolated in Thailand. Furthermore, artificial co-infection of these two viruses was prepared and carried out using two different ways of viral RNAs extraction. Based on the results, it could be reported that viral RNAs for cDNA amplification by multiplex RT-PCR could be extracted from a mixture of infected leaves or separate extraction of each viruses infected leaves. In addition, results presented in this study demonstrated the application of multiplex RT-PCR to simultaneously detect CGMMV and KGMMV from cucurbit leaves using a mixture of four primers and its feasibility as a sensitive and rapid laboratory assay. Since, no multiplex RT-PCR technique has been described for the detection of CGMMV and KGMMV, this technique can be a good option for sensitive and reliable tool for detection of two major cucurbit infecting Tobamoviruses.Keywords : Cucurbit infecting Tobamovirus, multiplex RT-PCR, seed borne viruses
oai:jurnal.ugm.ac.id:article/7834
2018-09-22T18:02:02Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7834
2018-09-22T18:02:02Z
Indonesian Journal of Biotechnology
Vol 16, No 1 (2011)
Characterization of Haemolysin of Staphylococcus aureus Isolated from Food of Animal Origin
Original Research Articles
Ariyanti, Dwi; , 2*, and
Salasia, Siti Isrina Oktavia
Tato, Syarifudin
2011-06-08 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7834
Staphylococcus aureus is an important pathogen bacteria causing food poisoning and various infection in animals and humans. Haemolysin is one of the virulence factors of Staphylococcus aureus. The aims of the research were to characterize haemolysins of Staphylococcus aureus isolated from various food of animal origin, phenotypic- and genotypically. In the present study, eleven Staphylococcus aureus isolated from various food of animal origins from traditional markets and supermarkets in Yogyakarta, Sidoarjo, Jakarta, and Bandung were characterized for haemolysin, pheno- and genotypically. Characterization of haemolysin phenotypically based on haemolysis pattern of Staphylococcus aureus on sheep blood agar plate. Genes encoding hemolysin were amplified with specific primers by using polymerase chain reaction (PCR) technique. The results of the studies showed that Staphylococcus aureus on sheep blood agar plates revealed an alpha haemolysis pattern (18,18%), beta haemolysis (27,27%) and gamma haemolysis (54,55%). Based on amplification of the gene encoding haemolysin of Staphylococcus aureus with specific primers showed hla genes (81,81%), and hla combined with hlb genes (18,18%). The amplification of gene hla and hlb had a single amplicon with a size of approximately 534 bp and 833 bp, respectively. The haemolysin characteristics of Staphylococcus aureus from various food of animal origin could be used as important information to control staphylococcal food poisoning.Keywords : Staphylococcus aureus, haemolysin, PCR, food of animal origins
oai:jurnal.ugm.ac.id:article/7835
2018-09-22T18:02:02Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7835
2018-09-22T18:02:02Z
Indonesian Journal of Biotechnology
Vol 16, No 1 (2011)
Antigen Presentation Ability of Salmonella Carrying DNA Vaccine Model and MCP-3 gene
Original Research Articles
Bachtiar, Endang Winiati
Smooker, Peter
Coloe, Peter J
2011-06-08 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7835
The objective of this study is to determine the antigen presentation ability of a DNA vaccine model that is co-delivered with that of recombinant Salmonella enterica serovar Typhimurium (STM1) expressing chemokine macrophage chemotactic protein-3 (MCP-3). The DNA vaccine, pVROVA, was constructed by amplification of the ovalbumin coding region from sOVA-C1. Dendritic cells (DCs) were obtained from IL-4 and GMCSF stimulated mouse bone marrow stem cell. Cultured DCs were incubated with STM1 carrying a model ovalbumin gene (pVROVA). Furthermore, MHC class I antigen presentation of a dominant OVA peptide was assayed in vitro. The experiments were designed to determine the effect of co-delivering MCP-3 with that of ovalbumin in STM1. Our results show that a plasmid pROVA-carrying ovalbumin gene was succesfully constructed and sequence analysis of the ovalbumin-coding revealed an identity match of 100% with that of the chicken ovalbumin DNA sequences from the GenBank database. We also found that the presence of the MCP-3 encoding plasmid in STM1 or E. coli DH1 could increase the recovery of both STM1 and E. coli DH1 over those that carry the empty plasmids. Antigen presentation assay also indicates that MCP-3 can positively influence the presentation of ovalbumin. Conclusion: the infection of DCs by STM1-carrying DNA vaccine and MCP-3 results in an increase of processing and presentation of ovalbumin in vitro.Keywords : DNA vaccine, MCP-3, APC, Salmonella, Dendritic cells
oai:jurnal.ugm.ac.id:article/7836
2018-09-22T18:03:08Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7836
2018-09-22T18:03:08Z
Indonesian Journal of Biotechnology
Vol 16, No 2 (2011)
Early Detection and Serotyping of Dengue Viruses Clinical Isolates Using Reverse Transcription Polymerase Chain Reaction (RT-PCR) 2 Primers
Original Research Articles
Siregar, Abdul Rahman
Wibawa, Tri
Wijayanti, Nastiti
2011-12-06 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7836
Recently several methods for confirming Dengue Virus have been developed involve virus isolation, detection of virus antigen, and nucleic acid using PCR. It has been reported that rapid detection method for confirming DHF by Multiplex RT-PCR had been successfully developed. It was more effective than the other methods with a high sensitivity and specivicity were 100% at the early phase (day 1-3). This study was designed to develop rapid detection and serotyping methods for Dengue Virus using RT-PCR 2 primers (Dcon and preM) with annealing temperature was 57oC. The whole blood samples were collected from suspected dengue fever patients that had been confirmed with NS1 kit from R.S. Persahabatan DKI Jakarta and R.S. Prof. Dr. Sardjito DI Yogyakarta during Februari-August 2009. The PCR products showed that in 12 samples, 100 % were postitive with different pattern among the serotypes especially for DEN1 and DEN2, but not for DEN3 and Den4. This method was also able to confirm the double infection DEN2-DEN3, but not for the other ones because of the unspecific pattern. From the results, it indicated that the 2 primers can be a promising early detection and serotyping method of Dengue Virus which infected the DHF patients. Key words: Dengue Virus, DHF, early detection, serotyping, RT-PCR 2 primers.
oai:jurnal.ugm.ac.id:article/7837
2018-09-22T18:03:08Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7837
2018-09-22T18:03:08Z
Indonesian Journal of Biotechnology
Vol 16, No 2 (2011)
Development of Random Amplified Polymorphism DNA Markers Linked to Powdery Mildew Resistance Gene in Melon
Original Research Articles
Daryono, Budi Setiadi
Aristya, Ganies Riza
Kasiamdari, Rina Sri
2011-12-06 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7837
A random amplified polymorphic DNA (RAPD) marker linked to powdery mildew resistance gene (Pm-I) in melon PI 371795 was reported. However, the RAPD marker has problem in scoring. To detect powdery mildew resistance gene (Pm-I) in melon accurately, the RAPD marker was cloned and sequenced to design sequence characterized amplified region (SCAR) markers. SCAPMAR5 marker derived from pUBC411 primer yielded a single DNA band at 1061 bp. Segregation of SCAPMAR5 marker in bulk of F2 plants demonstrated that the marker was co-segregated with RAPD marker from which the SCAR marker was originated. Moreover, results of SCAR analysis in diverse melons showed SCAPMAR5 primers obtained a single 1061 bp linked to Pm-I in resistant melon PI 371795 and PMAR5. On the other hand, SCAPMAR5 failed to detect Pm-I in susceptible melons. Results of this study revealed that SCAR analysis not only confirmed melons that had been clearly scored for resistance to Pm-I evaluated by RAPD markers, but also clarified the ambiguous resistance results obtained by the RAPD markers. Key words: Cucumis melo L., Pm-I, RAPD, SCAPMAR5
oai:jurnal.ugm.ac.id:article/7838
2016-11-10T09:18:20Z
ijbiotech:ART
oai:jurnal.ugm.ac.id:article/7839
2016-11-10T09:18:20Z
ijbiotech:ART
oai:jurnal.ugm.ac.id:article/7840
2016-11-10T09:18:20Z
ijbiotech:ART
oai:jurnal.ugm.ac.id:article/7841
2016-11-10T09:18:20Z
ijbiotech:ART
oai:jurnal.ugm.ac.id:article/7842
2016-11-10T09:18:20Z
ijbiotech:ART
oai:jurnal.ugm.ac.id:article/7843
2016-11-10T09:18:21Z
ijbiotech:ART
oai:jurnal.ugm.ac.id:article/7844
2016-11-10T09:18:21Z
ijbiotech:ART
oai:jurnal.ugm.ac.id:article/7845
2016-11-10T09:18:21Z
ijbiotech:ART
oai:jurnal.ugm.ac.id:article/7846
2018-09-22T18:03:45Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7846
2018-09-22T18:03:45Z
Indonesian Journal of Biotechnology
Vol 17, No 1 (2012)
Cytotoxic Activity of Tegari (Dianella nemorosa Lam.) Methanol Extract Against HeLa Cells
Original Research Articles
Karim, Aditya Krishar
Sismindari, S.
Asmara, Widya
Istriyati, I.
2012-06-03 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7846
Dianella nemorosa Lam. also known as tegari belonging to the Liliaceae family. This plant has been utilized for Papua traditional medicine as well as anticancer agent. This research examined potential cytotoxic activity of tegari (D. nemorosa) leaves extract against cervical cancer cell line (HeLa). Methanol extract was obtained by extracting the leaves powder using methanol. Extract was then applied into HeLa cell line to find out the cytotoxic activity. MTT [3-(4,5-dimetilthiazol-2-il)2,5-difeniltetrazolium bromida) assay was used to measure the cytotoxic activity. The result indicated that D. nemorosa leaves extract possessed cytotoxic activity in HeLa cell line with IC50 values were 685,69 µg/ml, 506,43 µg/ml and 708 µg/ml at the incubation period of 24, 48 and 72 h respectively. The strongest cytotoxic was showed by methanol extract incubated in 48 h.
oai:jurnal.ugm.ac.id:article/7847
2018-09-22T18:03:45Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7847
2018-09-22T18:03:45Z
Indonesian Journal of Biotechnology
Vol 17, No 1 (2012)
-429 T/C and -374 T/A Polymorphisms in Receptor Advanced Glycation Endproducts (RAGE) gene in Type 2 Diabetic Patients with Diabetic Retinopathy at the Dr. Sardjito General Hospital Yogyakarta
Original Research Articles
Djuma, Agustina Welhelmina; Master Program of Basic Medical Science and Biomedicine, Faculty of Medicine, Universitas Gadjah
Mada, Yogyakarta, Indonesia
Sunarti, S.; Department of Biochemistry, Faculty of Medicine, Universitas Gadjah Mada, Yogyakarta, Indonesia
Hastuti, Pramudji; Politeknik Kesehatan Kementerian Kesehatan, Kupang, Indonesia
2012-06-03 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7847
Receptor of advanced glycation endproduct (RAGE) plays an important role in the pathogenesis of diabetic vascular complications, such as diabetic retinopathy. The interaction between the RAGE and advanced glycation end product (AGE) leads to oxidative stress and could result in cellular activation and infl ammation. The production of AGE occurs normally during aging but it increases in hyperglycemia condition. The objective of this research was to investigate the association between -429 T/C and -374 T/A polymorphisms in RAGE gene with the risk of diabetic retinopathy (DR) of type 2 diabetic patients in Javanese population. This was a case control study which consisted of 40 type 2 diabetic patients with DR as case subjects and 40 type 2 diabetic patients without DR (NDR) as control subjects. Genotyping of polymorphism was performed by PCR-RFLP. Chi-square test and odds ratio models were used to evaluate the association of both polymorphisms and DR risk and to examine 2-SNP haplotype of -429 T/C and -374 T/A polymorphisms in RAGE gene on DR. The genotype frequencies of -429 T/C polymorphism in RAGE gene in DR subjects were TT = 72.5% and TC/CC = 27.5%; while in NDR subjects were TT = 80% and TC/ CC = 20%, with p = 0.431. The allele frequencies of -429 T/C polymorphism in DR subjects were T = 83.7% and C= 16.3%, while in NDR subjects were T = 87.5% and C = 12.5%, with p = 0.499. The genotype frequencies of -374T/A polymorphism in RAGE gene in DR subjects were TT = 67.5%, TA = 32.5% while in NDR subjects were TT =82.5%, TA = 17.5%, with p = 0.121. In DR subjects, the frequencies of T and A were 83.7% and16.3%, while in NDR subjects the frequencies of T and A were 91.2 % and 8.8%, with p = 0.151. Odds ratios of -429 T/C polymorphism were 1.52 (95% CI = 0.54 – 4.29) for TC/CC genotype and 1.358 (95% CI = 0.56 – 3.31) for C allele. Odds ratios of -374 T/A polymorphism were 2.27 (95% CI = 0.79 – 6.49) for TA genotype and 2.02 (95% CI = 0.76 – 5.37) for A allele. χ2-value for 2-SNP haplotype was p = 0.127. The -374 T/A polymorphism in RAGE gene was a stronger risk factor of DR than -429 T/C polymorphism in RAGE gene. There were not signifi cantly different of frequencies of genotypes, allele, and two-SNP haplotype of -429 T/C and -374 T/A polymorphisms in RAGE gene between DR subjects and NDR subjects.
oai:jurnal.ugm.ac.id:article/7848
2018-09-22T18:03:45Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7848
2018-09-22T18:03:45Z
Indonesian Journal of Biotechnology
Vol 17, No 1 (2012)
Production and Optimization of Oleic Acid Ethyl Ester Synthesis Using Lipase From Rice Bran (Oryza sativa L.) and Germinated Jatropha Seeds (Jatropha curcas L.) by Response Surface Methodology
Original Research Articles
Prastowo, Indro
Hidayat, Chusnul
Hastuti, Pramudji
2012-06-03 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7848
Recently, the fatty acid ethyl ester has been synthesized in place of fatty acid methyl ester since ethanol has been more renewable. In this research, oleic acid ethyl ester (OAEE) was synthesized using germinated jatropha seeds (Jatropha curcas.L) and rice bran (Oryza sativa) as source of lipase. The objective of the research was to optimize the synthesis conditions using Response Surface Methodology. Factors, such as crude enzyme concentration, molar ratio of oleic acid to ethanol, and the reaction time, were evaluated. The results show that lipase from germinated jatropha seeds had the hydrolitic and esterifi cation activity about 6.73 U/g and 298.07 U/g, respectively. Lipase from rice bran had the hydrolitic and esterifi cation activity about 10.57 U/g and 324.03 U/g, respectively. The optimum conditions of esterifi cation reaction using germinated jatropha seed lipase as biocatalyst were crude enzyme concentration of 0.31 g/ml, molar ratio of oleic acid to ethanol of 1 : 1.81, and reaction time of 50.9 min. The optimum conditions of esterifi cation reaction using rice bran lipase were crude enzyme concentration of 0.29 g/ml, molar ratio of oleic acid to ethanol of 1 : 2.05, and reaction time of 58.61 min. The obtained amounts of OAEE were 810.77 μmole and 626.92 μmole for lipases from rice bran and germinated jatropha seed, respectively.
oai:jurnal.ugm.ac.id:article/7849
2018-09-22T18:03:45Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7849
2018-09-22T18:03:45Z
Indonesian Journal of Biotechnology
Vol 17, No 1 (2012)
Diversity of Dibenzofuran-Utilizing Bacteria Isolated by Direct-Plating and Enrichment Methods
Original Research Articles
Prijambada, Irfan Dwidya
Widada, Jaka
Kusumaningtyas, Pintaka
Suryawan, Dhani
2012-06-03 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7849
The effect of enrichment bias on the diversity of Dibenzofuran (DBF)-degrading bacteria recovered from soil was evaluated by direct plating, plating after in-soil adaptation, and plating after batch culture enrichment. Among colonies appeared on Bushnell Haas agar with DBF as the sole carbon source, 119 colonies (49, 38, and 32 from direct plating, plating after in-soil adaptation, and plating after batch culture enrichment, respectively) were arbitrarily selected based on the appearance of the colonies. Total DNA were then extracted from the rest of the colonies and analyzed for their diversity using Ribosomal Intergenic Spacer Analysis (RISA). Number of DNA bands obtained from direct plating was higher than the ones obtained after in-soil enrichment and batch culture enrichment. The RISA bands obtained from direct plating were also found to be distributed more evenly than the ones obtained after in-soil enrichment and batch culture enrichment. Dominant bands were observed on RISA from samples obtained after in-soil enrichment and batch culture enrichment. Out of 119, only 9 isolates were consistently able to grow on Bushnell-Haas broth with DBF as the sole carbon source as indicated by broth turbidity. All of the isolates were obtained from soil samples which were enriched in a batch culture. Some of the isolates were able to degrade more then 80 % DBF in the minimal medium.
oai:jurnal.ugm.ac.id:article/7850
2018-09-22T18:03:45Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7850
2018-09-22T18:03:45Z
Indonesian Journal of Biotechnology
Vol 17, No 1 (2012)
Cloning and Expression of ORF124 Koi Herpesvirus as a Vaccine
Original Research Articles
Murwantoko, M.
Setyowati, Dewi Nur'aeni
Pratiwi, Rarastoeti
Kawaichi, Masashi
2012-06-03 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7850
Koi herpesvirus (KHV) which also known as Cyprinid herpesvirus 3 (CyHV-3), Koi herpes-like virus,and carp interstitial nephritis gill necrosis virus (CNGV), caused signifi cant morbidity and mortality in koiand common carp (Cyprinus carpio). The case fatality rate of this disease is 80–100%. Glycoprotein has beenused for vaccine development as sub unit vaccine against viruses. The aim of this research was to clone andexpress membrane glycoprotein ORF124 KHV as a candidate of recombinant vaccine. ORF124 KHV gene wassuccessfully cloned into pBSKS and sequenced. Result showed that ORF124 KHV (isolate from Indonesia) had100 % similarity with Cyprinid herpesvirus 3 strain TUMST1 (from Japan), 99% similarity with Koi herpesvirus strain KHV-U (from USA) and Koi herpesvirus strain KHV-I (from Israel). Prediction analysis of T and B cellepitopes showed that ORF124 KHV protein had 14 and 11 T cell epitopes (IAd, Rothbard/Taylor pattern),and had 10 B cell epitopes, suggested that the protein can be used as a vaccine candidate. ORF124 gene hasbeen expressed in Escherichia coli under pET32-a(+)vector.
oai:jurnal.ugm.ac.id:article/7851
2018-09-22T18:03:45Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7851
2018-09-22T18:03:45Z
Indonesian Journal of Biotechnology
Vol 17, No 1 (2012)
Isolation and Purifi cation of Chitinase Bacillus sp. D2 Isolated from Potato Rhizosfer
Original Research Articles
Margino, Sebastian
Behar, Chatarina
Asmara, Widya
2012-06-03 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7851
Potato Cyst Nematodes (Globodera rostochiensis) is one of the important potato’s pests and caused economic looses up to 70% in the several centrals of potato plantations in Indonesia. Potato Cyst Nematodes (PCN) shell component of egg shell containing chitin (inner layer) and vitelline/protein (outer layer), so the purpose of research was to fi nd out of chitin degrading bacteria for controlling of egg’s PCN by cutting of their life cycle. The results showed that Bacillus sp. D2 isolated from potato rhizosphere could produce extra cellular chitinase in the medium containing of 0.20% colloidal chitin and fermented for 72 hours. Result of chitinase purifi cation using ammonium sulphate precipitation and DEAE-Cellulose ion-exchange chromatography showed a specifi c activity 2691,052 U/mg and analyzing using SDS-PAGE 12.5% resulted in molecular weight 30 kDa. The apparent Km and Vmax of chitinase towards colloidal chitin were 2 mg/ml and 2.2 μg/h, respectively.
oai:jurnal.ugm.ac.id:article/7852
2018-09-22T18:03:45Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7852
2018-09-22T18:03:45Z
Indonesian Journal of Biotechnology
Vol 17, No 1 (2012)
Human Origin Lactobacillus casei Isolated from Indonesian Infants Demonstrating Potential Characteristics as Probiotics in vitro
Original Research Articles
Widodo, W.
Taufiq, Tiyas Tono
Aryati, Ety
Kurniawati, Asih
Asmara, Widya
2012-06-03 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7852
The aim of this experiment was to isolate and identify Lactic Acid Bacteria (LAB) from infant faecesand subsequent evaluation of its potential probiotics. LAB was isolated from faeces of infants who consumedbreast milk as the only source of diet on L-cysteine-supplemented MRS Agar, and incubated on 37oC for 48hours. Colonies grew on this media were then identifi ed based on morphological, physiological and molecularapproaches. Morphological and physiological identifi cations based on Gram staining, shape, motility, sporeformation, catalase, CO2 and NH3 production, and the ability to grow on temperature at 10oC and 45oC.Molecular identifi cation based on the amplifi cation of 16S rRNA gene. The potential application of selectedisolates for probiotics was evaluated based on the ability to grow on media with low pH and the additionof 0.5% bile salts, the ability to inhibit the growth of pathogenic Bacillus cereus and Eschericia coli, and in vitroadherence ability. On the basis of morphological, physiological and molecular analysis of 16S rRNA gene, itwas concluded that the selected isolate 1AF was a strain of Lactobacillus casei. Evaluation of probiotic in vitro showed that 60.4% of cells were resistant to pH 2.0 for 90 minutes. Survival of isolate 1AF after growing at0.5% bile salts was 70.8%. The selected isolate 1AF showed the ability to inhibit the growth of Eschericia coli and Bacillus cereus with inhibitory zone of 12.00±1,00 and 15.33±1.53 mm, respectively. In vitro study on theadherence value of isolate to solid plate was found at 46.5%. It is concluded that Lactobacillus casei isolate 1AFis a potential candidate as probiotics and subject to further in vivo evaluation.
oai:jurnal.ugm.ac.id:article/7853
2018-09-22T18:04:37Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7853
2018-09-22T18:04:37Z
Indonesian Journal of Biotechnology
Vol 17, No 2 (2012)
Genetic Variation Analysis of Mold (Magnaporthe oryzae B.Couch) Using Random Amplified Polymorphic DNA
Original Research Articles
Pramono, Ajeng Kusumaningtyas
Daryono, Budi Setiadi
2012-12-06 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7853
Magnaporthe oryzae B.Couch is a host-specific fungi, certain strain only infect certain host plant species. Genetic variety among M. oryzae isolates was explained by dendogram which was constructed using similarity data of Random Amplified Polymorphic DNA (RAPD). Dendogram construction was achieved by computer software, Numerical Taxonomy System (NTSYS). The aim of the research were to study the genetic variation among M. Oryzae using RAPD and to construct a dendogram of genetic similarities among the ten isolates from green foxtail (Setaria viridis L.), finger millet (Eleusine coracana L.) and rice (Oryza sativa L.).RAPD was performed in 30 cycles using 5 primers (OPA-02, OPA-03, OPA-04, OPA-05, OPA-07). Polymorphism data was used to constructed dendogram using Dice index and Unweighted Pair Group Method with Arithmetic Mean (UPGMA) in NTSYS software. There were 68 polymorphism fragments from 74 amplified fragments.Three clusters were formed in the dendrogram, based on host pathotype: foxtail millet type, finger millet type and rice type. There were two subclusters in foxtail millet type based on mating type, MAT1-1 dan MAT1-2. Thus, RAPD could be used as a method for genetic variation analysis of Magnaporthe oryzae to show host-specific specificity.Key words: Magnaporthe oryzae, RAPD, mating type
oai:jurnal.ugm.ac.id:article/7854
2018-09-22T18:04:37Z
ijbiotech:ART
v2
https://journal.ugm.ac.id/ijbiotech/article/view/7854
2018-09-22T18:04:37Z
Indonesian Journal of Biotechnology
Vol 17, No 2 (2012)
16s rRNA Identification of Pediococcus spp. from Broiler and Studies of Adherence Ability on Immobilized Mucus
Original Research Articles
Damayanti, Ema
Yusiati, Lies Mira
Dinoto, Achmad
2012-12-06 00:00:00
Articles published in IJBiotech are licensed under a Creative Commons Attribution-ShareAlike 4.0 International license. You are free to copy, transform, or redistribute articles for any lawful purpose in any medium, provided you give appropriate credit to the original author(s) and IJBiotech, link to the license, indicate if changes were made, and redistribute any derivative work under the same license.Copyright on articles is retained by the respective author(s), without restrictions. A non-exclusive license is granted to IJBiotech to publish the article and identify itself as its original publisher, along with the commercial right to include the article in a hardcopy issue for sale to libraries and individuals.By publishing in IJBiotech, authors grant any third party the right to use their article to the extent provided by the Creative Commons Attribution-ShareAlike 4.0 International license.
url:https://journal.ugm.ac.id/ijbiotech/article/view/7854
The objectives of this research were to study taxonomical status of lactic acid bacteria (LAB) isolated from broiler and adherence ability on mucus in vitro. Molecular analysis was performed by analyzing 16S rRNA gene using universal primer. The adherence assay on mucus was carried out using microplate method with total plate count (TPC), absorbance (A550) and confirmed by scanning electron microscopy (SEM). The results of this studies revealed that three of LAB isolates have closed relation to Pediococcus acidilactici (99.9%) species.Three isolates of P. acidilactici have adherence ability on broiler mucus higher than that on porcine mucin with an adherence percentage of 55.5% versus 50.8% and absorbance A550 of 0.061 versus 0.051, respectively. The highest adherence ability showed by P. acidilactici R02 with adherence percentage was 59.3% and absorbance A550 = 0.068. Adherence on mucus were affected by the addition of 3 g/l of gastric juice and 0.3% (b/v) of bile salt. Adherence analysis using SEM also showed that the adherence on broiler mucus was higher than the adherence on porcine mucin. Altogether this adherence studies, suggest that three isolates of P. acidilactici LAB were capable of colonizing host intestinal mucus in vitro as important property to be promising probiotic bacteria for broiler.Key words : adherence, broiler, Pediococcus, mucus, 16S rRNA
eb5116a403e3ad5b127ec3b3af0dfacb